I want to change the amino acid encoded by the highlighted codon below. If I was using the primer listed in overlap extension PCR, to what amino acid would I be aiming to change it to? ATG GAA CTT CAT TGT CCC AAA GTA CTA CTA TAT CAG GTA TTG Primer: TTGTCCCAAAGGACTACTATATC
Added by Girija R.
Step 1
The highlighted codon is CCC which codes for the amino acid Proline. Show more…
Show all steps
Your feedback will help us improve your experience
Danielle Ashley and 98 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
What amino acid is coded for by each of the following mRNA codons? a. CCA b. AAC $\mathrm{c}_{4} \mathrm{GGU}$ d. AGG
Nucleic Acids and Protein Synthesis
The Genetic Code and Protein Synthesis
Consult the genetic code to write codon changes that could account for the following changes in amino acid sequence: a. tryptophan to arginine b. glycine to valine c. tyrosine to histidine
What is the amino acid for each of the following codons? (21.6) a. UUU UUC b. AAA AAG c. CGU CGC CGA CGG
Viruses
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
18,000,000+
Students on Numerade
Trusted by students at 8,000+ universities
Watch the video solution with this free unlock.
EMAIL
PASSWORD