Mechanism of Phosphodiester Bond Formation Incoming dNTP Pyrophosphate Primer strand Template strand Draw the mechanism of dATP addition to a strand with dCTP at the end – is this happening at the 5? or 3? end of the DNA? A. 5? B. 3? Discuss – will this mechanism differ for RNA synthesis? A. Yes B. No
Added by Jamie M.
Close
Step 1
The addition of dATP to a DNA strand with dCTP at the end involves the formation of a phosphodiester bond. This happens at the 3' end of the DNA strand, so the answer to the first question is B. 3'. Show more…
Show all steps
Your feedback will help us improve your experience
Adi S and 80 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
In this sequence, the top strand is part of a strand of DNA that is being replicated: 5' AGGTAGACCGAACTCGAGGTA -3'. The bottom strand is an RNA primer. Why is a primer needed during replication? What is the first nucleotide that a DNA polymerase would add to this primer? When that nucleotide is added, what bonds will it form with other nucleotides? Describe the types of bonds that form and where they form (between what parts of the nucleotides). What is the difference in the chemical structure of the 5' and the 3' ends of a DNA strand?
Adi S.
3. One strand of portion of a DNA molecule has the following sequence. 5' C T A T T G C T A C C G A 3' a) what is the complimentary sequence to this given sequence? b) what kind of bond joins one nucleotide to another in the DNA strand? c) which portion/s of the nucleotide (nitrogenous base, phosphate group, or pentose sugar) is involved in the formation of that bond that joins nucleotides together in the DNA strand? d) which enzyme/s catalyze the formation of that bond? e) what kind of bond joins one strand of DNA to another in the double helix? f) which portion/s of the nucleotide (nitrogenous base, phosphate group, or pentose sugar) is involved in the formation of that holds together the two strands in one DNA molecule? g) during the process of DNA replication, what protein breaks those bonds between the two DNA strands? h) which protein will help keep those separated DNA strands apart?
Madhur L.
(b) What is the sequence of the strand of DNA that was sequenced (not synthesized) in part a? Indicate the 3'- and 5'- polarity of the sequence in your answer. [answer to a): 3'-TGTCAGGTCTACATAAGCGTT-5'] (c) If the strand of DNA in b is the sense (coding) strand during transcription, what RNA sequence would be expected?
Sri K.
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
Watch the video solution with this free unlock.
EMAIL
PASSWORD