Principles of Genetics

D. Peter Snustad, Michael J. Simmons

Chapter 16

Applications of Molecular Genetics - all with Video Answers

Educators

Chapter Questions

Problem 1

What are $\mathrm{CpG}$ islands? Of what value are $\mathrm{CpG}$ islands in positional cloning of human genes?

Dennis Howard

Dennis Howard

Numerade Educator

Problem 2

Why is the mutant gene that causes Huntington's disease called buntingtin? Why might this gene be renamed in the future?

Dennis Howard

Numerade Educator

Problem 3

How was the nucleotide sequence of the $C F$ gene used to obtain information about the structure and function of its gene product?

Dennis Howard

Numerade Educator

Problem 4

How might the characterization of the $C F$ gene and its product lead to the treatment of cystic fibrosis by somatic-cell gene therapy? What obstacles must be overcome before cystic fibrosis can be treated successfully by gene therapy?

Dennis Howard

Numerade Educator

Problem 5

Myotonic dystrophy (MD), occurring in about 1 of 8000 individuals, is the most common form of muscular dystrophy in adults. The disease, which is characterized by progressive muscle degeneration, is caused by a dominant mutant gene that contains an expanded CAG repeat region. Wild-type alleles of the $M D$ gene contain 5 to 30 copies of the trinucleotide. Mutant $M D$ alleles contain 50 to over 2000 copies of the CAG repeat. The complete nucleotide sequence of the $M D$ gene is available. Design a diagnostic test for the mutant gene responsible for myotonic dystrophy that can be carried out using genomic DNA from newborns, fetal cells obtained by amniocentesis, and single cells from eight-cell pre-embryos produced by in vitro fertilization.

Dennis Howard

Numerade Educator

Problem 6

In humans, the absence of an enzyme called purine nucleoside phosphorylase (PNP) results in a severe T-cell immunodeficiency similar to that of severe combined immunodeficiency disease (SCID). PNP deficiency exhibits an autosomal recessive pattern of inheritance, and the gene encoding human PNP has been cloned and sequenced. Would PNP deficiency be a good candidate for treatment by gene therapy? Design a procedure for treatment of PNP deficiency by somatic-cell gene therapy.

Dennis Howard

Numerade Educator

Problem 7

Human proteins can now be produced in bacteria such as $E .$ coli. However, one cannot simply introduce a human gene into $E .$ coli and expect it to be expressed. What steps must be taken to construct an $E .$ coli strain that will produce a mammalian protein such as human growth hormone?

Dennis Howard

Numerade Educator

Problem 8

You have constructed a synthetic gene that encodes an enzyme that degrades the herbicide glyphosate. You wish to introduce your synthetic gene into Arabidopsis plants and test the transgenic plants for resistance to glyphosate. How could you produce a transgenic Arabidopsis plant harboring your synthetic gene by $A$. tumefaciens-mediated transformation?

Dennis Howard

Numerade Educator

Problem 9

A human STR locus contains a tandem repeat $(\mathrm{TAGA})_{n}$ where $n$ may be between 5 and $15 .$ How many alleles of this locus would you expect to find in the human population?

Dennis Howard

Numerade Educator

Problem 10

A group of bodies are found buried in a forest. The police suspect that they may include the missing Jones family (two parents and two children). They extract DNA from bones and examine the DNA profiles of STR loci $A$ and $B,$ which are known to contain tandem repeats of variable length. They also analyze the DNA profiles of two other men. The results are shown in the following table where the numbers indicate the number of copies of the tandem repeat in a particular allele; for example, male 1 has one allele with 8 and another allele with 9 copies of a tandem repeat in locus $$\begin{array}{lll}\text { male 1 } & 8 / 9 & 5 / 7 \\ \text { male 2 } & 6 / 8 & 5 / 5 \\ \text { male 3 } & 7 / 10 & 7 / 7 \\ \text { woman } & 8 / 8 & 3 / 5 \\ \text { child 1 } & 7 / 8 & 5 / 7 \\ \text { child 2 } & 8 / 8 & 3 / 7\end{array}$$
Could the woman have been the mother of both children? Why or why not? Which man, if any, could have been the father of child 1 ?

Dennis Howard

Numerade Educator

Problem 11

DNA profiles have played central roles in many rape and murder trials. What is a DNA profile? What roles do DNA profiles play in these forensic cases? In some cases, geneticists have been concerned that DNA profile data were being used improperly. What were some of their concerns, and how can these concerns be properly addressed?

Dennis Howard

Numerade Educator

Problem 12

The DNA profiles shown in this problem were prepared using genomic DNA from blood cells obtained from a woman, her daughter, and three men who all claim to be the girl's father.
Based on the DNA profiles, what can be determined about paternity in this case?

Dennis Howard

Numerade Educator

Problem 13

Most forensic experts agree that profiles of DNA from blood samples obtained at crime scenes and on personal items can provide convincing evidence for murder convictions. However, the defense attorneys sometimes argue successfully that sloppiness in handling blood samples results in contamination of the samples. What problems would contamination of blood samples present in the interpretation of DNA profiles? Would you expect such errors to lead to the conviction of an innocent person or the acquittal of a guilty person?

Dennis Howard

Numerade Educator

Problem 14

The Ti plasmid contains a region referred to as T-DNA. Why is this region called T-DNA, and what is its significance?

Dennis Howard

Numerade Educator

Problem 15

The generation of transgenic plants using $A$. tumefaciensmediated transformation often results in multiple sites of insertion. These sites frequently vary in the level of transgene expression. What approaches could you use to determine whether or not transgenic plants carry more than one transgene and, if so, where the transgenes are inserted into chromosomes?

Dennis Howard

Numerade Educator

Problem 16

"Disarmed" retroviral vectors can be used to introduce genes into higher animals, including humans. What advantages do retroviral vectors have over other kinds of gene-transfer vectors? What disadvantages?

Dennis Howard

Numerade Educator

Problem 17

Transgenic mice are now routinely produced and studied in research laboratories throughout the world. How are transgenic mice produced? What kinds of information can be obtained from studies performed on transgenic mice? Does this information have any importance to the practice of medicine? If so, what?

Dennis Howard

Numerade Educator

Problem 18

Two men claim to be the father of baby Joyce Doe. Joyce's mother had her CODIS STR DNA profile analyzed and was homozygous for allele 8 at the TPOX locus (allele 8 contains eight repeats of the GAAT sequence at this polymorphic locus). Baby Joyce is heterozygous for alleles 8 and 11 at this locus. In an attempt to resolve the disputed paternity, the two men were tested for their STR DNA profiles at the TPOX locus on chromosome 2 . Putative father 1 was heterozygous for alleles 8 and 11 at the TPOX locus, and putative father 2 was homozygous for allele 11 at this locus. Can these results resolve this case of disputed paternity? If so, who is the biological father? If not, why not?

Dennis Howard

Numerade Educator

Problem 19

Many valuable human proteins contain carbohydrate or lipid components that are added posttranslationally. Bacteria do not contain the enzymes needed to add these components to primary translation products. How might these proteins be produced using transgenic animals?

Dennis Howard

Numerade Educator

Problem 20

Richard Meagher and coworkers have cloned a family of 10 genes that encode actins (a major component of the cytoskeleton) in Arabidopsis thaliana. The 10 actin gene products are similar, often differing by just a few amino acids. Thus, the coding sequences of the 10 genes are also very similar, so that the coding region of one gene will cross-hybridize with the coding regions of the other nine genes. In contrast, the noncoding regions of the 10 genes are quite divergent. Meagher has hypothesized that the 10 actin genes exhibit quite different temporal and spatial patterns of expression. You have been hired by Meagher to test this hypothesis. Design experiments that will allow you to determine the temporal and spatial pattern of expression of each of the 10 actin genes in Arabidopsis.

Dennis Howard

Numerade Educator

Problem 21

The first transgenic mice resulted from microinjecting fertilized eggs with vector DNA similar to that diagrammed in Figure 16.15 except that it contained a promoter for the mammalian metallothionein gene linked to the $H G H$ gene. The resulting transgenic mice showed elevated levels of $\mathrm{HGH}$ in tissues of organs other than the pituitary gland, for example, in heart, lung, and liver, and the pituitary gland underwent atrophy. How might the production of HGH in transgenic animals be better regulated, with expression restricted to the pituitary gland?

Dennis Howard

Numerade Educator

Problem 22

How do the reverse genetic approaches used to dissect biological processes differ from classical genetic approaches?

Dennis Howard

Numerade Educator

Problem 23

How can RNAi gene silencing be used to determine the function of genes?

Dennis Howard

Numerade Educator

Problem 24

How do insertional mutagenesis approaches differ from other reverse genetic approaches?

Dennis Howard

Numerade Educator

Problem 25

Insertional mutagenesis is a powerful tool in both plants and animals. However, when performing large-scale insertional mutagenesis, what major advantage do plants have over animals?

Dennis Howard

Numerade Educator

Problem 26

We discussed the unfortunate effects of insertional mutagenesis in the four boys who developed leukemia after treatment of X-linked severe combined immunodeficiency disease by gene therapy. How might this consequence of gene therapy be avoided in the future? Do you believe that the use of somatic-cell gene therapy to treat human diseases can ever be made 100 percent risk free? Why? Why not?

Dennis Howard

Numerade Educator

Problem 27

One strand of a gene in Arabidopsis thaliana has the following nucleotide sequence:
atgagtgacgggaggaggaagaagagcgtgaacggaggtgcacc ggcgcaaacaatcttggatgatcggagatctagtcttccggaagtt gaagcttctccaccggctgggaaacgagctgttatcaagagtgcc gatatgaaagatgatatgcaaaaggaagctatcgaaatcgccatctcc gcgtttgagaagtacagtgtggagaaggatatagctgagaatata aagaaggagtttgacaagaaacatggtgctacttggcattgcattgtt ggtcgcaactttggttcttatgtaacgcatgagacaaaccatttcgtt tacttctacctcgaccagaaagctgtgctgctcttcaagtcgggttaa
The function of this gene is still uncertain.
(a) How might insertional mutagenesis be used to investigate its function?
(b) Design an experiment using RNA interference to probe the function(s) of the gene.

Dennis Howard

Numerade Educator

Problem 28

Let's check the Salk Institute's Genome Analysis Laboratory web site (http://signal.salk.edu/cgi-bin/tdnaexpress) to see if any of their T-DNA lines have insertions in the gene shown in the previous question. At the SIGnAL web site, scroll down to "Blast" and paste or type the sequence in the box. The resulting map will show the location of mapped T-DNA insertions relative to the location of the gene (green rectangle at the top). The blue arrows at the top right will let you focus on just the short region containing the gene or relatively long regions of chromosome 4 of Arabidopsis. Are there any T-DNA insertions in the gene in question? near the gene?

Dennis Howard

Numerade Educator