Holt: Modern Chemistry

Mickey Sarquis, Jerry L. Sarquis

Chapter 23

Biological Chemistry - all with Video Answers

Educators

KM

+ 1 more educators

Chapter Questions

Problem 1

Describe the general chemical formula of carbohydrates.

Julie Guaglianone

Julie Guaglianone

Numerade Educator

Problem 2

Name two examples from each of the following classes of carbohydrates: monosaccharides, disaccharides, and polysaccharides.

Julie Guaglianone

Julie Guaglianone

Numerade Educator

Problem 3

What different roles do the polysaccharides starch and cellulose play in plant systems?

Ricajoy Montero

Ricajoy Montero

Numerade Educator

Problem 4

What word is used to describe fatty acids that contain at least one double bond?

Julie Guaglianone

Julie Guaglianone

Numerade Educator

Problem 5

Why are some triglycerides liquid, while others are solid?

Julie Guaglianone

Julie Guaglianone

Numerade Educator

Problem 6

What reagents are used to make soaps?

Julie Guaglianone

Julie Guaglianone

Numerade Educator

Problem 7

Draw the structural formula for glucose.

Julie Guaglianone

Julie Guaglianone

Numerade Educator

Problem 8

Using structural formulas, write the equation showing the formation of maltose, which is the disaccharide made of two glucose units.

Julie Guaglianone

Julie Guaglianone

Numerade Educator

Problem 9

Write the equation representing the formation of a soap molecule from stearic acid, $\mathrm{C}_{17} \mathrm{H}_{35} \mathrm{COOH},$ and sodium hydroxide.

Julie Guaglianone

Julie Guaglianone

Numerade Educator

Problem 10

Describe the structure of an amino acid. Then, explain how amino acids become linked together to form a protein.

Julie Guaglianone

Julie Guaglianone

Numerade Educator

Problem 11

Circle and identify the carboxylic acid groups and the amino groups in the following molecule:

Dalton Hilovsky

Dalton Hilovsky

Numerade Educator

Problem 12

Can two types of enzymes contain the same number and kinds of amino acids? Explain.

Julie Guaglianone

Julie Guaglianone

Numerade Educator

Problem 13

What happens when a protein is denatured?

Ramesh Singh

Numerade Educator

Problem 14

Explain the cause of the genetic disease sickle cell anemia.

Susan Hallstrom

Susan Hallstrom

Numerade Educator

Problem 15

Why is the water solubility of fibrous proteins so different from that of globular proteins?

Ramesh Singh

Numerade Educator

Problem 16

Draw the structures of two dipeptides made up of glycine and valine.

Julie Guaglianone

Julie Guaglianone

Numerade Educator

Problem 17

How many different tripeptides can be formed from two molecules of glycine and one molecule of cysteine? Write all the structures by using the three-letter codes Gly and Cys.

Julie Guaglianone

Julie Guaglianone

Numerade Educator

Problem 18

What chemical gains the metabolic energy that is released as glucose is broken down in the body?

Saman Zulfiqar

Numerade Educator

Problem 19

What does ATP stand for? What is the role of ATP in living organisms?

Mariana Roldan

Numerade Educator

Problem 20

Describe the steps that occur in the digestion of fats.

rb

Rabia Bibi

Numerade Educator

Problem 21

Review the following diagram of catabolism.

According to the diagram, what could happen in the cell when glucose and glycogen reserves are nearly gone?

Bryan Valdivia

Numerade Educator

Problem 22

Write the structural formula of ATP. Circle the bond that breaks when ADP forms.

Julie Guaglianone

Julie Guaglianone

Numerade Educator

Problem 23

What are the three components of a nucleotide?

David Collins

Numerade Educator

Problem 24

How are the two chains of DNA held together?

Bryan Valdivia

Numerade Educator

Problem 25

Describe in general terms the process of DNA replication.

Rashmi Sinha

Numerade Educator

Problem 26

What are the main differences between DNA and RNA?

Dennis Howard

Numerade Educator

Problem 27

Describe the similarities and differences between the three kinds of RNA molecules.

Kayla Scholl

Numerade Educator

Problem 28

What is a ribosome? What is the function of a ribosome in a cell?

James Kiss

Numerade Educator

Problem 29

The following sequence of bases might be found on the gene that codes for oxytocin, the human pituitary hormone:
TACACAATGTAAGTTTTGACGGGGGACCCTATC
a. What is the base sequence of the complementarystrand of DNA?
b. What is the base sequence that would occur on a strand of mRNA transcribed from the oxytocin DNA sequence?

Julie Guaglianone

Julie Guaglianone

Numerade Educator

Problem 30

Name the four main elements that make up compounds found in living organisms.

Caryl Abrenica

Numerade Educator

Problem 31

In each of the following groups, one of the items does not belong in the group. Identify the odd item in the group and explain why it is different. Explain how the other items are related.
a. glycogen, starch, fructose, and cellulose
b. amino acids, dipeptides, polypeptides, and proteins
c. fats, oils, and fatty acids
d. cytosine, adenine, and uracil

Kendrick Buford

Kendrick Buford

Numerade Educator

Problem 32

What is the human body’s storage form of each of the following?
a. glucose
b. lipids
c. protein

Christy Bales, Ph.D.

Christy Bales, Ph.D.

Numerade Educator

Problem 33

Is each of the following statements about proteins and triglycerides true or false?
a. Both contain the amide functional group.
b. Both are a part of a major class of biochemical molecules.
c. Both hydrolyze in order to enter the metabolic pathway in humans.

Shahina -

Numerade Educator

Problem 34

Circle the hydrophobic part in each of the figures shown below.

Christina Sorrentino

Christina Sorrentino

Numerade Educator

Problem 35

Both celery and potato chips are composed of molecules that are polymers of glucose. Explain why celery is a good snack for people on a diet while potato chips are not.

KM

Kara Mcdonald

Numerade Educator

Problem 36

Carbohydrates, fats, and proteins can produce energy for an organism.
a. Which class of substances most rapidly provides energy?
b. Which class can be used as a building material in the human body?
c. Which is the most efficient as an energy storage system?

Ashok Prajapati

Ashok Prajapati

Numerade Educator

Problem 37

Describe the basic structure of the cell membrane. What is the cell membrane’s main function?

Amy Jiang

Numerade Educator

Problem 38

Interpreting Concepts A diet that consists primarily of corn can result in a protein-deficiency disease called kwashiorkor. What does this information indicate about the protein content of corn?

Sam Limsuwannarot

Sam Limsuwannarot

Numerade Educator

Problem 39

Inferring Relationships Explain how a similar reaction forms three kinds of biological polymers: polysaccharides, polypeptides, and nucleic acids.

Ricajoy Montero

Ricajoy Montero

Numerade Educator

Problem 40

Evaluating Ideas Some diets recommend severely restricting or eliminating the intake of carbohydrates. Why is it not a good idea to eliminate all carbohydrates from the diet?

Jennifer Hudspeth

Jennifer Hudspeth

Numerade Educator

Problem 41

Using Analogies Explain why the model of enzyme action is called the lock-and-key model.

NR

Noah Robinson

Numerade Educator

Problem 42

Conduct library research about how Olestra® decreases fat and caloric content of potato chips. What are the advantages and disadvantages of Olestra® in food products?

Kari Hasz

Numerade Educator

Problem 43

Write a summary discussing what you have learned about the four major classes of organic compounds found in living organisms—carbohydrates, lipids, proteins, and nucleic acids. Include a description of how these organic molecules are used by the body.

David Collins

Numerade Educator

Problem 44

Amylase, the enzyme present in the mouth, catalyzes the digestion of starch. The pH of the mouth is almost neutral.
a. Do you think that amylase is active in the stomach after you swallow the food? Why or why not?
b. Design an experiment you could perform to test your answer to item a. Note: A common test for the presence of starch is the addition of tincture of iodine, which will produce a blue color if starch is present.

Qudsiya Anis

Numerade Educator