Chapter 11, Gene Expression and Differentiation Video Solutions, Must Know High School Biology

Problem 1

Fill in the blanks: The process of is when an undifferentiated cell begins to selectively express certain genes and turns into a specific tissue type.

Dennis Howard

Numerade Educator

01:12

Problem 2

Why is a promoter important to transcription?

Peggy Radtke

Numerade Educator

00:36

General transcription factors are small proteins that bind to the and help to land properly. If the cell needs to create a lot of mRNA, however, it needs the help of specific transcription factors called

Unlike the general transcription factors, these specific transcription factors bind upstream of the promoter at sequences in the DNA called regions.

Sam Limsuwannarot

Numerade Educator

01:14

Problem 4

Choose the correct term from each pair of words: By adding methyl groups to DNA/histones gene transcription will be increased/decreased. If, instead, acetyl groups are added to DNA/histones gene transcription will be increased/decreased.

Joanna Quigley

Numerade Educator

01:34

Problem 5

General transcription factors bind at the within the promoter, whereas specific transcription factors (activators) bind at a specific combination of in the region.

Christina Sorrentino

Numerade Educator

07:17

Problem 6

Is the $\operatorname{trp}$ operon an inducible or repressible operon? What does this mean regarding the availability of tryptophan in $E$. coli's environment?

Jenny Wu

Numerade Educator

02:08

Problem 7

For each of the following, indicate whether the statement is true or false:
a. During transcription, the entire chromosome is unwound and unzipped.
b. The process of transcription involves the enzyme RNA polymerase moving down the entire chromosome and creating a piece of mRNA.
c. For a given gene, only one side of the DNA double helix contains the correct code for protein synthesis.

Sylvia Puglisi

Numerade Educator

00:56

Problem 8

What is the role of general transcription factors in gene expression?

Mystique Till

Numerade Educator

04:29

Problem 9

Label the following picture:

Jessica Ballard

Numerade Educator

02:04

Problem 10

Transcribe and translate the following gene (top strand is the template strand):
GCTACTGATCGACCCCCATAATGAAAATCTTTT
CGATGACTAGCTGGGGGTATTACTTTTAGAAAA

Marina Ramsey

Numerade Educator

00:46

Problem 11

Select the right term from the pair: The lac operon is a(n) inducible/repressible operon because it is normally not transcribing the genes for lactose digestion.