• Home
  • Textbooks
  • Genetics: From Genes to Genomes
  • Gene Expression: The Flow of Genetic Information from DNA to RNA to Protein

Genetics: From Genes to Genomes

Leland H. Hartwell, Leroy Hood, Michael L. Goldberg, Ann E. Reynolds, Lee M. Silver, Rurh C. Veres

Chapter 8

Gene Expression: The Flow of Genetic Information from DNA to RNA to Protein - all with Video Answers

Educators

Chapter Questions

03:45

Problem 1

For each of the terms in the left column, choose the best matching phrase in the right column.
a. codon
b. colinearity
c. reading frame
d. frameshift mutation
e. degeneracy of the genetic code
f. nonsense codon
g. initiation codon
h. template strand
i. RNA-like strand
j. intron
k. RNA splicing
1. transcription
m. translation
n. alternative splicing
o. charged tRNA
p. reverse transcription
1. removing base sequences corresponding to introns from the primary transcript
2. UAA, UGA, or UAG
3. the strand of DNA that has the same base sequence as the primary transcript
4. a transfer RNA molecule to which the appropriate amino acid has been attached
5. a group of three mRNA bases signifying one amino acid
6. most amino acids are not specified by a single codon
7. using the information in the nucleotide sequence of a strand of DNA to specify the nucleotide sequence of a strand of RNA
8. the grouping of mRNA bases in threes to be read as codons
9. AUG in a particular context
10. the linear sequence of amino acids in the polypeptide corresponds to the linear sequence of nucleotide pairs in the gene
11. produces different mature mRNAs from the same primary transcript
12. addition or deletion of a number of base pairs other than three into the coding sequence
13. a sequence of base pairs within a gene that is not represented by any bases in the mature mRNA
14. the strand of DNA having the base sequence complementary to that of the primary transcript
15. using the information encoded in the nucleotide sequence of an mRNA molecule to specify the amino-acid sequence of a polypeptide molecule
16. copying RNA into DNA

Marisa A
Marisa A
Numerade Educator
02:48

Problem 2

Match the hypothesis from the left column to the observation from the right column that gave rise to it.
2. exbitence of an
iltremediate messenger
berween DNA and prosein
b. the genetic code is nonoverlapping
c. the codoe is more that one nucleotide
4. the genetic code is based on triplets of bases
c. stop codons exist and tennisate translation
L. the amino acid sequence of a protein depends ce be base sequence of an mRNA
1. two matations affecting the same amino acid can recombine to give wild type
2. one or two base deletions (or insertions) in a gene disrupt its function; three buse deletions (or insertions) are offen comb. pacitile with function
3. artificial messages containing certain codons produced slorter proteins thun messages not containing those codoes
4. prowein symethesis occurs in the cyooplasen, while DNA resides in the nucleus
5. artificial messages wib different base sequences gave rise wo differemp pooteins in in the wion manslation system
6. single buse sulstitutions affect only oete amino acid in the prosein clain

Marisa A
Marisa A
Numerade Educator
04:47

Problem 3

How would the artificial mRNA $5^{\prime}$. . GUGUGUGU .. $3^{\prime}$ be read according to each of the following models for the genetic code?
a. two-base, not overlapping
b. two-base, overlapping
c. three-base, not overlapping
d. three-base, overlapping
e. four-base, not overlapping

Khalida Dawar
Khalida Dawar
Numerade Educator
03:50

Problem 4

An example of a portion of the T4 rIIB gene in which Crick and Brenner had recombined one + and one - mutation is shown here. (The RNA-like strand of the DNA is shown.)
w11d type $5^{\prime}$ AMA AGT CCA TCA CTT AAT GCC 3'
mutant $\quad 5^{\prime}$ AMA GTC CAT CAC TTA ATG GCC $3^{\prime}$
a. Where are the + and - mutations in the mutant DNA?
b. What alterations in amino acids occurred in this double mutant, which produces wild-type plaques?
c. How can you explain the fact that amino acids are different in the double mutant compared to the wild-type sequence, yet the phage is wild type?

Khalida Dawar
Khalida Dawar
Numerade Educator
02:36

Problem 5

In the HbS allele (sickle-cell allele) of the human $\beta$ globin gene, the sixth amino acid in the $\beta$-globin chain is changed from glutamic acid to valine. In $H b C$, the sixth amino acid in $\beta$ globin is changed from glutamic acid to lysine. What would be the order of these two mutations within the map of the $\beta$-globin gene?

Jennifer Stoner
Jennifer Stoner
Numerade Educator
05:03

Problem 6

The following diagram describes the mRNA sequence of part of the $A$ gene and the beginning of the $B$ gene of phage $\phi \mathrm{X} 174$. In this phage, there are some genes that are read in overlapping reading frames. For example, the code for the $A$ gene is used for part of the $B$ gene, but the reading frame is displaced by one base. Shown here is the single mRNA with the codons for proteins A and B indicated.
\begin{tabular}{lllllllllllll}
aa & 5 & 6 & 7 & a & 9 & 10 & 11 & 12 & 13 & 14 & 15 & 16 \\
A & AlaLysG1uTrpASnAsnSerLeuLys ThrLysLeu
\end{tabular}

Given the following amino acid changes, indicate the base change that occurred in the mRNA and the consequences for the other protein sequence.
a. Asn at position 10 in protein A is changed to Tyr.
b. Leu at position 12 in protein A is changed to Pro.
c. Gln at position 8 in protein B is changed to Leu.
d. The occurrence of overlapping reading frames is very rare in nature. When it does occur, the extent of the overlap is not very long. Why do you think this is the case?

Ceyda Guley
Ceyda Guley
Numerade Educator
05:56

Problem 7

The amino acid sequence of part of a protein has been determined:
N . . . Gly Ala Pro Arg Lys . . . C
A mutation has been induced in the gene encoding this protein using the mutagen proflavin. The resulting mutant protein can be purified and its amino acid sequence determined. The amino acid sequence of the mutant protein is exactly the same as the amino acid sequence of the wild-type protein from the N terminus of the protein to the glycine in the preceding sequence. Starting with this glycine, the sequence of amino acids is changed to the following:
N . . Gly His Gln Gly Lys . . . C

Using the amino acid sequences, one can determine the sequence of 14 nucleotides from the wild-type gene encoding this protein. What is this sequence?

Sana Riaz
Sana Riaz
Numerade Educator
02:39

Problem 8

When the artificial mRNA $5^{\prime} \ldots$ UCUCUCUC . . . 3' was added to an in vitro protein synthesis system, investigators found that proteins composed of alternating leucine and serine were made. What experiments were done to determine whether leucine was specified by CUC and serine by UCU, or vice versa?

Luis Daniel
Luis Daniel
Numerade Educator
03:07

Problem 9

Identify all the amino acid-specifying codons where a point mutation (a single base change) could generate a nonsense codon.

Bryan Valdivia
Bryan Valdivia
Numerade Educator
03:45

Problem 10

Translate all the sequences shown in Fig. 8.6 on p. 261, assuming that in each case the RNA-like strand of the gene is depicted.

Marisa A
Marisa A
Numerade Educator
03:54

Problem 11

A particular protein has the amino acid sequence
N . . . Ala-Pro-His-Trp-Arg-Lys-Gly-Val-Thr . . . C
within its primary structure. A geneticist studying mutations affecting this protein discovered that several of the mutants produced shortened protein molecules that terminated within this region. In one of them, the His became the terminal amino acid.
a. What DNA single-base change(s) would cause the protein to terminate at the His residue?
b. What other potential sites do you see in the DNA sequence encoding this protein where mutation of a single base pair would cause premature termination of translation?

Marisa A
Marisa A
Numerade Educator
02:53

Problem 12

In studying normal and mutant forms of a particular human enzyme, a geneticist came across a particularly interesting mutant form of the enzyme. The normal enzyme is 227 amino acids long, but the mutant form was 312 amino acids long, having that extra 85 amino acids as a block in the middle of the normal sequence. The inserted amino acids do not correspond in any way to the normal protein sequence. What are possible explanations for this phenomenon? How would you distinguish among them?

Jennifer Stoner
Jennifer Stoner
Numerade Educator
05:30

Problem 13

How many possible open reading frames (frames without stop codons) are there that extend through the following sequence?
5'. . CTTACAGITTATTGATACGGMGAAGG . . . 3*
$3^{\prime} \ldots$ GAATGTCAAATAACTATGCCTCTTCC...5'

Khalida Dawar
Khalida Dawar
Numerade Educator
02:03

Problem 14

a. In Fig. 8.4 on p. 259 , the physical map (the number of base pairs) is not exactly equivalent to the genetic map (in map units). Explain this apparent discrepancy.
b. In Fig. 8.4, which region shows the highest rate of recombination, and which the lowest?

Jennifer Stoner
Jennifer Stoner
Numerade Educator
01:32

Problem 15

The sequence of a segment of mRNA, beginning with the initiation codon, is given here, along with the comesponding sequences from several mutant strains.
Normal 1 AUGACACAUCGAGGGGUGGUAAACCCUAAG...
Mutant 1 AugaCACAUCCAGGGGUgGUAAACCCUAAG...
Mutant 2 AUgACACAUCGAGgGUgGUAAACCCUAAG...
Mutant 3 AUgACGCAuCgAGgGGugguAAACCCUAAG...
Mutant 4 AUGACACAUCGAGGGGUUGGUAAACCCUAAG...
Mutant 5 AUGACACAUUGAGGGgUGgUAACCCUAAG...
Mutant 6 AugacAuUuACCACCCCUCGAUGCCCUAAG...
a. Indicate the type of mutation present in each and translate the mutated portion of the sequence into an amino acid sequence in each case.
b. Which of the mutations could be reverted by treatment with EMS (ethylmethane sulfonate; see Fig. 7.10 on pp. 218-219)? With proflavin?

Sam Limsuwannarot
Sam Limsuwannarot
Numerade Educator
02:37

Problem 16

You identify a proflavin-generated allele of a gene that produces a 110 -amino acid polypeptide rather than the usual 157 -amino acid protein. After subjecting this mutant allele to extensive proflavin mutagenesis, you are able to find a number of intragenic suppressors located in the part of the gene between the sequences encoding the N -terminus of the protein and the original mutation but no suppressors located in the region between the original mutation and the sequences encoding the usual C -terminus of the protein. Why do you think this is the case?

Khalida Dawar
Khalida Dawar
Numerade Educator
03:33

Problem 17

Describe the steps in transcription that require complementary base pairing.

Marisa A
Marisa A
Numerade Educator
04:30

Problem 18

Chapters 6 and 7 explained that mistakes made by DNA polymerase are corrected either by proofreading mechanisms during DNA replication or by DNA repair systems that operate after replication is complete. The overall rate of errors in DNA replication is about $1 \times 10^{-10}$, that is, one error in 10 million base pairs. RNA polymerase also has some proofreading capability, but the overall error rate for transcription is significantly higher ( $1 \times 10^{-4}$, or one error in each 1000 nucleotides). Why can organisms tolerate higher error rates for transcription than for DNA replication?

Ceyda Guley
Ceyda Guley
Numerade Educator
02:51

Problem 19

The coding sequence for gene $F$ is read from left to right on the following figure. The coding sequence for gene $G$ is read from right to left. Which strand of DNA (top or bottom) serves as the template for transcription of each gene?

Khalida Dawar
Khalida Dawar
Numerade Educator
03:22

Problem 20

If you mixed the mRNA of a human gene with the genomic DNA for the same gene and allowed the RNA and DNA to form a hybrid, what would you be likely to see in the electron microscope? Your figure should include hybridization involving both DNA strands (template and RNA-like) as well as the mRNA.

Kemuel Roberts
Kemuel Roberts
Numerade Educator
01:05

Problem 21

Describe the steps in translation that require complementary base pairing.

Bryan Valdivia
Bryan Valdivia
Numerade Educator
View

Problem 22

Locate as accurately as possible the listed items that are shown on the following figure. Some items are not shown. (a) $5^{\prime}$ end of DNA template strand; (b) $3^{\prime}$ end of mRNA; (c) ribosome; (d) promoter, (c) codon; (f) an amino acid; (g) DNA polymerase; (h) $5^{\prime}$ UTR; (i) centromere; (j) intron; (k) anticodon; (1) N terminus; (m) $5^{\prime}$ end of charged tRNA; (n) RNA polymerase; (o) $3^{\prime}$ end of uncharged tRNA; (p) a nucleotide; (q) mRNA cap; (r) peptide bond; (s) P site; (t) aminoacyl-tRNA synthetase; (u) hydrogen bond; (v) exon; (w) 5' AUG 3'; (x) potential "wobble" interaction.

Marisa A
Marisa A
Numerade Educator
03:47

Problem 23

Concerning the figure for the previous problem (\#22):
a. Which process is being represented?
b. What is the next building block to be added to the growing chain in the figure? To what end of the growing chain will this building block be added? How many building blocks will there be in the chain when it is completed?
c. What other building blocks have a known identity?
d. What details could you add to this figure that would be different in a eukaryotic cell versus a prokaryotic cell?

Khalida Dawar
Khalida Dawar
Numerade Educator
03:11

Problem 24

In prokaryotes, a search for genes in a DNA sequence involves scanning the DNA sequence for long open reading frames (that is, reading frames uninterrupted by stop codons). What problem can you see with this approach in eukaryotes?

Khalida Dawar
Khalida Dawar
Numerade Educator
11:18

Problem 25

The yeast gene encoding a protein found in the mitotic spindle was cloned by a laboratory studying mitosis. The gene encodes a protein of 477 amino acids.
a. What is the minimum length in nucleotides of the protein-coding part of this yeast gene?
b. A partial sequence of one DNA strand in an exon containing the middle of the coding region of the yeast gene is given here. What is the sequence of nucleotides of the mRNA in this region of the gene? Show the $5^{\prime}$ and $3^{\prime}$ directionality of your strand.
5' GTAMGITAACTtTCGMCTAGTCCAGGGT 3'
c. What is the sequence of amino acids in this part of the yeast mitotic spindle protein?

Jenny Wu
Jenny Wu
Numerade Educator
05:12

Problem 26

The sequence of a complete eukaryotic gene encoding the small protein Met Tyr Arg Gly Ala is shown here. All of the written sequences on the template strand are transcribed into RNA.
5' CCCCTATGCCCCCCTGGGGGAGGATCAAAACACTTACCTGTACATGGC 3'
$3^{\prime}$ GGGGATACGGGGGGACCCCCTCCTAGTTTTGTGAATGGACATGTACCC $5^{\prime}$
a. Which strand is the template strand? Which direction (right to left or left to right) does RNA polymerase move along the template as it transcribes this gene?
b. What is the sequence of the nucleotides in the processed mRNA molecule for this gene? Indicate the $5^{\prime}$ and $3^{\prime}$ polarity of this mRNA.
c. A single base mutation in the gene results in synthesis of the peptide Met Tyr Thr. What is the sequence of nucleotides making up the mRNA produced by this mutant gene?

Jennifer Stoner
Jennifer Stoner
Numerade Educator
02:25

Problem 27

Using recombinant DNA techniques (which will be described in Chapter 9), it is possible to take the DNA of a gene from any source and place it on a chromosome in the nucleus of a yeast cell. When you take the DNA for a human gene and put it into a yeast cell chromosome, the altered yeast cell can make the human protein. But when you remove the DNA for a gene normally present on yeast mitochondrial chromosomes and put it on a yeast chromosome in the nucleus, the yeast cell cannot synthesize the correct protein, even though the gene comes from the same organism. Explain. What would you need to do to ensure that such a yeast cell could make the correct protein?

James Kiss
James Kiss
Numerade Educator
06:20

Problem 28

a. The genetic code table shown in Fig. 8.3 on p. 257 applies both to humans and to E. coli. Suppose that you have purified a piece of DNA from the human genome containing the entire gene encoding the hormone insulin. You now transform this piece of DNA into $E$. coli. Why can't $E$. coli cells containing the human insulin gene actually make insulin?
b. Pharmaceutical companies have actually been able to obtain E. coli cells that make human insulin; such insulin can be purified from the bacterial cells and used to treat diabetic patients. How were the pharmaceutical companies able to create such "bacterial factories" for making insulin?

Jennifer Stoner
Jennifer Stoner
Numerade Educator
View

Problem 29

Arrange the following list of eukaryotic gene elements in the order they would appear in the genome and in the direction traveled by RNA polymerase along the gene. Assume the gene's single intron interrupts the open reading frame. Note that some of these names are abbreviated and thus do not distinguish between elements in DNA versus RNA. For example, "splicedonor site" is an abbreviation for "DNA sequences transcribed into the splice-donor site" because splicing takes place on the gene's RNA transcript, not on the gene itself. Geneticists often use this kind of shorthand for simplicity, even though it is imprecise. (a) splicedonor site; (b) $3^{\prime}$ UTR; (c) promoter, (d) stop codon; (e) nucleotide to which methylated cap is added; (f) initiation codon; (g) transcription terminator; (h) spliceacceptor site; (i) $5^{\prime}$ UTR; (j) poly-A addition site; (k) splice branch site.

Marisa A
Marisa A
Numerade Educator
02:02

Problem 30

Concerning the list of eukaryotic gene elements in the previous problem (\#29):
a. Which of the element names in the list are abbreviated? (That is, which of these elements actually occur in the gene's primary transcript or mRNA rather than in the gene itself?)
b. Which of the elements in the list are found partly or completely in the first exon of this gene (or the RNA transcribed from this exon)? In the intron? In the second exon?

Jennifer Stoner
Jennifer Stoner
Numerade Educator
11:30

Problem 31

Do you think each of the following types of mutations would have very severe effects, mild effects, or no effect at all?
a. Nonsense mutations occurring in the sequences encoding amino acids near the N terminus of the protein
b. Nonsense mutations occurring in the sequences encoding amino acids near the C terminus of the protein
c. Frameshift mutations occurring in the sequences encoding amino acids near the N terminus of the protein
d. Frameshift mutations occurring in the sequences encoding amino acids near the C terminus of the protein
e. Silent mutations
f. Conservative missense mutations
g. Nonconservative missense mutations affecting the active site of the protein
h. Nonconservative missense mutations not in the active site of the protein

Khalida Dawar
Khalida Dawar
Numerade Educator
05:51

Problem 32

Null mutations are valuable genetic resources because they allow a researcher to determine what happens to an organism in the complete absence of a particular protein. However, it is often not a trivial matter to determine whether a mutation represents the null state of the gene.
a. Geneticists sometimes use the following test for the "nullness" of an allele in a diploid organism: If the abnormal phenotype seen in a homozygote for the allele is identical to that seen in a heterozygote where one chromosome carries the allele in question and the homologous chromosome is known to be completely deleted for the gene, then the allele is null. What is the underlying rationale for this test? What limitations might there be in interpreting such a result?
b. Can you think of other methods to determine whether an allele represents the null state of a particular gene?

Jennifer Stoner
Jennifer Stoner
Numerade Educator
10:30

Problem 33

The following is a list of mutations that have been discovered in a gene that has more than 60 exons and encodes a very large protein of 2532 amino acids. Indicate whether or not each mutation could cause a detectable change in the size or the amount of mRNA and/or a detectable change in the size or the amount of the protein product. (Detectable changes in size or amount must be greater than $1 \%$ of normal values.) What kind of change would you predict?
a. Lys 576 Val (changes amino acid 576 from lysine into valine)
b. Lys 576 Arg
c. AAG576AAA (changes codon 576 from AAG to AAA)
d. AAG576UAG
e. Met1Arg (there are at least two possible scenarios for this mutation)
f. promoter mutation
g. one base-pair insertion into codon 1841
h. deletion of codon 779
i. IVS18DS, G-A, +1 (this mutation changes the first nucleotide in the eighteenth intron of the gene, causing exon 18 to be spliced to exon 20 , thus skipping exon 19)
j. deletion of the poly-A addition site
k. G-to-A substitution in the $5^{\prime}$ UTR
1. insertion of 1000 base pairs into the sixth intron (this particular insertion does not alter splicing)

Ceyda Guley
Ceyda Guley
Numerade Educator
06:01

Problem 34

Considering further the mutations described in the previous problem (\#33):
a. Which of the mutations could be null mutations?
b. Which of the mutations would be most likely to result in an allele that is recessive to wild type?
c. Which of the mutations could result in an allele dominant to wild type? What mechanism(s) could explain this dominance?

Susan Hallstrom
Susan Hallstrom
Numerade Educator
01:35

Problem 35

When 1 million cells of a culture of haploid yeast carrying a met auxotrophic mutation were plated on petri plates lacking methionine (met), five colonies grew. You would expect cells in which the original met $^{-}$mutation was reversed (by a base change back to the original sequence) would grow on the media lacking methionine, but some of these apparent reversions could be due to a mutation in a different gene that somehow suppresses the original met ${ }^{-}$mutations. How would you be able to determine if the mutations in your five colonies were due either to a precise reversion of the original met ${ }^{-}$mutation or to the generation of a suppressor mutation in a gene on another chromosome?

Jennifer Stoner
Jennifer Stoner
Numerade Educator
06:01

Problem 36

a. What are the differences between null, hypomorphic, hypermorphic, dominant negative, and neomorphic mutations?
b. For each of these kinds of mutations, would you predict they would be dominant or recessive to a wild-type allele in producing a mutant phenotype?

Susan Hallstrom
Susan Hallstrom
Numerade Educator
02:38

Problem 37

A mutant $B$. adonis bacterium has a nonsense suppressor tRNA that inserts glutamine (Gln) to match a UAG (but not other nonsense) codons.
a. What is the anticodon of the suppressing tRNA? Indicate the $5^{\prime}$ and $3^{\prime}$ ends.
b. What is the sequence of the template strand of the wild-type tRNA ${ }^{\mathrm{Gln}}$-encoding gene that was altered to produce the suppressor, assuming that only a single-base-pair alteration was involved?
c. What is the minimum number of $t R N A^{G i n}$ genes that could be present in a wild-type B. adonis cell? Describe the corresponding anticodons.

Hailey Tomashek
Hailey Tomashek
Numerade Educator
01:59

Problem 38

You are studying mutations in a bacterial gene that codes for an enzyme whose amino acid sequence is known. In the wild-type protein, proline is the fifth amino acid from the amino terminal end. In one of your mutants with nonfunctional enzyme, you find a serine at position number 5 . You subject this mutant to further mutagenesis and recover three different strains. Strain A has a proline at position number 5 and acts just like wild type. Strain B has tryptophan at position number 5 and also acts like wild type. Strain C has no detectable enzyme function at any temperature, and you can't recover any protein that resembles the enzyme. You mutagenize strain C and recover a strain (C-1) that has enzyme function. The second mutation in C-1 responsible for the recovery of enzyme function does not map at the enzyme locus.
a. What is the nucleotide sequence in both strands of the wild-type gene at this location?
b. Why does strain B have a wild-type phenotype? Why does the original mutant with serine at position 5 lack function?
c. What is the nature of the mutation in strain C ?
d. What is the second mutation that arose in C-1?

Jennifer Stoner
Jennifer Stoner
Numerade Educator
01:35

Problem 39

Another class of suppressor mutations, not described in the chapter, are mutations that suppress missense mutations.
a. Why would bacterial strains carrying such missense suppressor mutations generally grow more slowly than strains carrying nonsense suppressor mutations?
b. What other kinds of mutations can you imagine in genes encoding components needed for gene expression that would suppress a missense mutation in a protein-coding gene?

Jennifer Stoner
Jennifer Stoner
Numerade Educator
03:25

Problem 40

Yet another class of suppressor mutations not described in the chapter are mutations in TRNA genes that can suppress frameshift mutations. What would have to be true about a tRNA that could suppress a frameshift mutation involving the insertion of a single base pair?

Khalida Dawar
Khalida Dawar
Numerade Educator
02:38

Problem 41

There is at least one nonsense suppressing tRNA known that can suppress more than one type of nonsense codon.
a. What is the anticodon of such a suppressing tRNA?
b. What stop codons would it suppress?
c. What are the amino acids most likely to be carried by this nonsense suppressing tRNA?

Hailey Tomashek
Hailey Tomashek
Numerade Educator
01:18

Problem 42

An investigator was interested in studying UAG nonsense suppressor mutations in bacteria. In one species of bacteria, she was able to select two different mutants of this type, one in the $t R N A^{\text {Tjr }}$ gene and the other in the $t R N A^{G i n}$ gene, but in a second species, she was not able to obtain any such nonsense suppressor mutations, even after very extensive effort. What could explain the difference between the two species?

Jennifer Stoner
Jennifer Stoner
Numerade Educator