• Home
  • Textbooks
  • Biology Now
  • How Genes Work

Biology Now

Anne Houtman; Megan Scudellari; Cindy Malone

Chapter 10

How Genes Work - all with Video Answers

Educators


Chapter Questions

01:01

Problem 1

Link each term with the correct definition.

Joanna Quigley
Joanna Quigley
Numerade Educator
01:29

Problem 3

For each of the following, identify the type of RNA involved (mRNA, rRNA, or tRNA).
_____ a. Transports the correct amino acid to the ribosome, using the information encoded in the mRNA.
_____ b. Is a major component of ribosomes.
_____ c. Specifies the order of amino acids in a protein, using a series of three-base codons, where different amino acids are specified by particular codons.
_____ d. Contains a three-base anticodon that pairs with a complementary codon revealed in the mRNA.
_____ e. Assists in making the bonds that link amino acids together to make a protein.

Joanna Quigley
Joanna Quigley
Numerade Educator
01:01

Problem 3

Select the correct terms:
The genetic code demonstrates (ambiguity / redundancy) because some amino acids are coded by more than one codon. The lack of (ambiguity / redundancy) in the genetic code is evidenced by the fact that each codon codes for one, and only one, amino acid.

Joanna Quigley
Joanna Quigley
Numerade Educator
01:21

Problem 4

In the diagram of transcription shown here, fill in the blanks with the appropriate terms: (a) gene; (b) promoter; (c) terminator;
(d) RNA polymerase; (e) mRNA.

Joanna Quigley
Joanna Quigley
Numerade Educator
02:53

Problem 5

Place the following steps of translation in the correct order by numbering them from 1 to 9 .
_____ a. A tRNA molecule carrying the amino acid methionine binds at its anticodon site to the mRNA start codon.
_____ b. The ribosome links the first amino acid to the second amino acid to begin the amino acid chain.
_____ C. The ribosome continues to link each amino acid to the growing amino acid chain.
_____ d. The ribosome reaches a stop codon.
_____ e. An mRNA binds to a ribosome.
_____ f. The mRNA and the completed amino acid chain separate from the ribosome.
_____ g. The first tRNA, separated from its amino acid, releases from the mRNA.
_____ h. A tRNA molecule carrying the second amino acid binds to the second mRNA codon.
_____ i. Each tRNA releases from the mRNA after it is separated from its amino acid.

Joanna Quigley
Joanna Quigley
Numerade Educator
01:12

Problem 6

Which of the following are possible reasons that a cell would regulate its expression of a gene? (Select all that apply.)
(a) an increased need for a particular enzyme
(b) a decreased need for a particular enzyme
(c) increasing temperature in the external environment
(d) changing needs as an organism ages
(e) death

Joanna Quigley
Joanna Quigley
Numerade Educator
01:13

Problem 7

Using the genetic code shown in Figure 10.9 , find the amino acid coded by each of the following codons.
(a) $\mathrm{AAU}$
(b) UAA
(c) AUA
(d) GGG
(e) CCC

Joanna Quigley
Joanna Quigley
Numerade Educator
01:18

Problem 8

Using the genetic code shown in Figure 10.9 , find a codon that codes for each of the following amino acids.
(a) arginine
(b) alanine
(c) methionine
(d) glycine

Joanna Quigley
Joanna Quigley
Numerade Educator
01:05

Problem 9

During transcription, what RNA molecule will be made from the DNA template CGTTACG?
(a) CGTTAGC
(b) GCAAUGC
(c) GCATTGC
(d) CGUUAGC

Joanna Quigley
Joanna Quigley
Numerade Educator
01:23

Problem 10

Which amino acid sequence will be generated during translation from the following small mRNA: ...CCC-AUG-UCUUCG-UUA-UGA-UUG...? (Hint: Remember where translation starts and stops.]
(a) Met-Glu-Arg-Arg-Glu-Leu
(b) Met-Ser-Ser-Leu-Leu
(c) Pro-Met-Ser-Ser-Leu-Leu
(d) Pro-Met-Ser-Ser-Leu
(e) Met-Ser-Ser-Leu

Joanna Quigley
Joanna Quigley
Numerade Educator
01:47

Problem 11

Some diseases (for example, Huntington's and Parkinson's) appear to be related to increasing protein levels in brain cells, which lead eventually to cell death. At which of the control points shown in Figure 10.11 might a gene regulation error be occuring with these diseases? Identify one control point at which the error would result in up-regulation of gene expression, and one control point at which the error would result in down-regulation of gene expression.

Joanna Quigley
Joanna Quigley
Numerade Educator
01:10

Problem 12

The following nucleic acid is an entire primary transcript (pre-mRNA not yet processed): ACGCAUGCGaugaugccccucag GUCUguuuccgugaUGCCGUUGACCUGA. The nucleotides in capitals are exons; and the nucleotides in lowercase type are introns. Appropriately splice this primary transcript.
(a) ACGCAUGCGGUCUUGCCGUUGACCUGA
(b) augccuuucagguuuccguga
(c) augccuuucagGUCUguuuccguga
(d) ACGCAUGCGaugGUCUUGCCGUUGACCUGA
(e] ACGCAUGCGaugccuagGUCUguuuccgugaUGCCGUUGACC UGA

Joanna Quigley
Joanna Quigley
Numerade Educator
01:07

Problem 13

How is gene expression similar to DNA replication, and how is it different? Give at least one similarity and one difference.

Joanna Quigley
Joanna Quigley
Numerade Educator
01:47

Problem 14

Write Now biology: genotype to phenotype Your roommate, who is also taking a biology class, has become a little confused. He informs you that the genetic code is known to be ambiguous because a given genotype may give rise to a variety of phenotypes during gene expression (for example, his twin brother is an inch taller and more tan than he is). You like your roommate and would
like him to pass his next biology exam, so you decide to help him. Write him a brief note explaining (a) why the genetic code is not, in fact, ambiguous and (b) how gene expression derives a phenotype from a genotype.

Joanna Quigley
Joanna Quigley
Numerade Educator
02:19

Problem 15

What do you think? Most people carry two copies of a normal gene that codes for an enzyme, glucosylceramidase, that is involved in breaking down lipids no longer needed in cells. (Enzymes are proteins that cause specific chemical changes; they are biological catalysts.) One in 100 people in the United States carries a recessive mutation that codes for a defective glucosylceramidase enzyme. And about one in 40,000 people carries two copies of the mutation and displays the symptoms of Gaucher disease. These symptoms, caused by the accumulation of lipids in cells, include anemia, enlarged organs, swollen glands and joints, and, in severe cases, neurological problems and early death.
Enzyme replacement therapy is effective but very expensive-about \$200,000 annually-and must be continued, every 2 weeks, for life. The Israeli biotech company Protalix Biotherapeutics, working with the U.S.-based Pfizer Pharmaceuticals, has developed a process to genetically modify carrots to produce a replacement enzyme. The biopharmed enzyme will cost about 25 percent less than the standard enzyme therapies, which are grown in mammalian cell lines. Protalix is now working on treatments for other enzyme deficiency diseases. The FDA's May 2012 approval of the drug developed by Protalix alarmed some environmental activists and health
advocates, who fear that the company's genetically modified carrot is just the beginning of a wedge that will lead to an underregulated and potentially dangerous industry. There is some legitimacy to their concerns: the U.S. Department of Agriculture (USDA) does not require an environmental impact assessment for biopharmed crops; nor does it require biotech companies to share the location of their test fields or the identity of the biopharmed molecules being produced. Furthermore, the USDA is not sufficiently staffed to effectively monitor companies involved in biopharming. What do you think? Should biopharming be allowed in the United States? If so, under what conditions and with what limits? For example, should it be allowed to produce drugs for only life-threatening illnesses, or only under highly controlled conditions? Be prepared to discuss your observations and reflections in class.

Joanna Quigley
Joanna Quigley
Numerade Educator
04:12

Problem 16

Life choices Go to the Centers for Disease Control and Prevention (CDC) influenza website (http://www.cdc.gov/flu) and read the pages "Key Facts About Influenza (Flu)" (under "Flu Basics"] and "Key Facts About Seasonal Flu Vaccine" (under "Prevention-Flu Vaccine"). You can also go to the Mayo Clinic's influenza website (http://www.mayoclinic.org/diseases
-conditions/flu/home/ovc-20248057]. Then answer the following questions.
a. What is the flu? How is it passed on?
b. What are the possible symptoms and complications of the flu?
c. How can you decrease your chance of getting the flu, and what treatments are available if you become infected?
d. What are the benefits and risks of the flu vaccine?
e. Why is there a new flu vaccine every year?
f. Why is the flu vaccine more effective in some years than in others?
g. Who would you recommend should get the flu vaccine? Explain your reasoning.
h. Do you get a flu vaccine every year? Why or why not?

Joanna Quigley
Joanna Quigley
Numerade Educator