Chapter 8, Nucleotides and Nucleic Acids Video Solutions, Lehninger Principles of Biochemistry

Problem 1

Which positions in a purine ring of a purine nucleotide in DNA have the potential to form hydrogen bonds but are not involved in Watson-Crick base pairing?

Niamat Khuda

Numerade Educator

04:02

One strand of a double-helical DNA has the sequence (5') GCGCAATATTTCTCAAAATATTGCGC (3'). Write the base sequence of the complementary strand. What special type of sequence is contained in this DNA segment? Does the double-stranded DNA have the potential to form any alternative structures?

Niamat Khuda

Numerade Educator

01:24

Problem 3

Calculate the weight in grams of a double-helical DNA molecule stretching from the earth to the moon $(-320,000 \mathrm{~km})$. The DNA double helix weighs about $1 \times 10^{-18} \mathrm{~g}$ per 1,000 nucleotide pairs; each base pair extends $3.4 \AA$. For an interesting comparison, your body contains about 0.5 g of DNA!

Prashant Bana

Numerade Educator

03:32

Problem 4

Assume that a poly (A) tract five base pairs long produces a $20^{\circ}$ bend in a DNA strand. Calculate the total (net) bend produced in a DNA if the center base pairs (the third of five) of two successive (dA) 5 tracts are located (a) 10 base pairs apart; (b) 15 base pairs apart. Assume 10 base pairs per turn in the DNA double helix.

Niamat Khuda

Numerade Educator

02:05

Problem 5

Hairpins may form at palindromic sequences in single strands of either RNA or DNA. How is the helical structure of a long and fully base-paired (except at the end) hairpin in RNA different from that of a similar hairpin in DNA?

Niamat Khuda

Numerade Educator

03:01

Problem 6

The cells of many eukaryotic organisms have highly specialized systems that specifically repair G-T mismatches in DNA. The mismatch is repaired to form a $\mathrm{G} \equiv \mathrm{C}($ not $\mathrm{A}=\mathrm{T})$ base pair. This $\mathrm{G}-\mathrm{T}$ mismatch repair mechanism occurs in addition to a more general system that repairs virtually all mismatches. Can you suggest why cells might require a specialized system to repair G-T mismatches?

Pronoy Sinha

Numerade Educator

04:26

Problem 7

Explain why the absorption of UV light by double-stranded DNA increases (hyperchromic effect) when the DNA is denatured.

Niamat Khuda

Numerade Educator

02:33

Problem 8

The concentration of protein or nucleic acid in a solution containing both can be estimated by using their different light absorption properties: proteins absorb most strongly at 280 nm and nucleic acids at 260 nm . Their respective concentrations in a mixture can be estimated by measuring the absorbance (A) of the solution at 280 nm and 260 nm and using the table below, which gives $R_{280 / 260}$, the ratio of absorbances at 280 and 260 nm ; the percentage of total mass that is nucleic acid; and a factor, $F$, that corrects the $\mathrm{A}_{280}$ reading and gives a more accurate protein estimate. The protein concentration (in $\mathrm{mg} / \mathrm{ml}$ ) $=F \times A_{280}$ (assuming the cuvette is 1 cm wide). Calculate the protein concentration in a solution of $\mathrm{A}_{280}=0.69$ and $\mathrm{A}_{260}=0.94$
$$
\begin{array}{|c|c|c|}
\hline R_{280 / 260} & \begin{array}{l}
\text { Proportion of } \\
\text { nucleic acid (\%) }
\end{array} & \text { F } \\
\hline 1.75 & 0.00 & 1.116 \\
\hline 1.63 & 0.25 & 1.081 \\
\hline 1.52 & 0.50 & 1.054 \\
\hline 1.40 & 0.75 & 1.023 \\
\hline 1.36 & 1.00 & 0.994 \\
\hline 1.30 & 1.25 & 0.970 \\
\hline 1.25 & 1.50 & 0.944 \\
\hline 1.16 & 2.00 & 0.899 \\
\hline 1.09 & 2.50 & 0.852 \\
\hline 1.03 & 3.00 & 0.814 \\
\hline 0.979 & 3.50 & 0.776 \\
\hline 0.939 & 4.00 & 0.743 \\
\hline 0.874 & 5.00 & 0.682 \\
\hline 0.846 & 5.50 & 0.656 \\
\hline 0.822 & 6.00 & 0.632 \\
\hline 0.804 & 6.50 & 0.607 \\
\hline 0.784 & 7.00 & 0.585 \\
\hline 0.767 & 7.50 & 0.565 \\
\hline 0.753 & 8.00 & 0.545 \\
\hline 0.730 & 9.00 & 0.508 \\
\hline 0.705 & 10.00 & 0.478 \\
\hline 0.671 & 12.00 & 0.422 \\
\hline 0.644 & 14.00 & 0.377 \\
\hline 0.615 & 17.00 & 0.322 \\
\hline 0.595 & 20.00 & 0.278 \\
\hline
\end{array}
$$

Niamat Khuda

Numerade Educator

02:47

Problem 9

In samples of DNA isolated from two unidentified species of bacteria, X and Y, adenine makes up $32 \%$ and $17 \%$, respectively, of the total bases. What relative proportions of adenine, guanine, thymine, and cytosine would you expect to find in the two DNA samples? What assumptions have you made? One of these species was isolated from a hot spring $\left(64^{\circ} \mathrm{C}\right)$. Suggest which species is the thermophilic bacterium. What is the basis for your answer?

Dennis Howard

Numerade Educator

05:31

Problem 10

Draw the following structures and rate their relative solubilities in water (most soluble to least soluble): deoxyribose, guanine, phosphate. How are these solubilities consistent with the threedimensional structure of double-stranded DNA?

Niamat Khuda

Numerade Educator

02:50

Problem 11

The following DNA fragment was sequenced by the Sanger method. The red asterisk indicates a fluorescent label.
Compound can't copy
A sample of the DNA was reacted with DNA polymerase and each of the nucleotide mixtures (in an appropriate buffer) listed below. Dideoxynucleotides (ddNTPs) were added in relatively small amounts.
1. dATP, dTTP, dCTP, dGTP, ddTTP
2. dATP, dTTP, dCTP, dGTP, ddGTP
3. dATP, dCTP, dGTP, ddTTP
4. dATP, dTTP, dCTP, dGTP

The resulting DNA was separated by electrophoresis on an agarose gel, and the fluorescent bands on the gel were located. The band pattern resulting from nucleotide mixture 1 is shown below. Assuming that all mixtures were run on the same gel, what did the remaining lanes of the gel look like?
Figure can't copy

Rabeya Zahid

Numerade Educator

04:49

Problem 12

An exonuclease is an enzyme that sequentially cleaves nucleotides from the end of a polynucleotide strand. Snake venom phosphodiesterase, which hydrolyzes nucleotides from the $3^{\prime}$ end of any oligonucleotide with a free $3^{\prime}$-hydroxyl group, cleaves between the $3^{\prime}$ hydroxyl of the ribose or deoxyribose and the phosphoryl group of the next nucleotide. It acts on single-stranded DNA or RNA and has no base specificity. This enzyme was used in sequence determination experiments before the development of modern nucleic acid sequencing techniques. What are the products of partial digestion by snake venom phosphodiesterase of an oligonucleotide with the following sequence?
(5') GCGCCAUUGC (3')-OH

Niamat Khuda

Numerade Educator

02:23

Problem 13

Bacterial endospores form when the environment is no longer conducive to active cell metabolism. The soil bacterium Bacillus subtilis, for example, begins the process of sporulation when one or more nutrients are depleted. The end product is a small, metabolically dormant structure that can survive almost indefinitely with no detectable metabolism. Spores have mechanisms to prevent accumulation of potentially lethal mutations in their DNA over periods of dormancy that can exceed 1,000 years. B. subtilis spores are much more resistant than the organism's growing cells to heat, UV radiation, and oxidizing agents, all of which promote mutations.
(a) One factor that prevents potential DNA damage in spores is their greatly decreased water content. How would this affect some types of mutations?
(b) Endospores have a category of proteins called small acid-soluble proteins (SASPs) that bind to their DNA, preventing formation of cyclobutane-type dimers. What causes cyclobutane dimers, and why do bacterial endospores need mechanisms to prevent their formation?

Sana Riaz

Numerade Educator

02:02

Problem 14

Elucidation of the threedimensional structure of DNA helped researchers understand how this molecule conveys information that can be faithfully replicated from one generation to the next. To see the secondary structure of double-stranded DNA, go to the Protein Data Bank website (www.rcsb.org/pdb). Use the PDB identifiers listed below to retrieve the data pages for the two forms of DNA. Open the structures using RasMol or Chime, and use the different viewing options to complete the following exercises.
(a) Obtain the file for 141D, a highly conserved, repeated DNA sequence from the end of the HIV-1 (the virus that causes AIDS) genome. Display the molecule as a stick or ball-and-stick structure. Identify the sugar-phosphate backbone for each strand of the DNA duplex. Locate and identify individual bases. Which is the $5^{\prime}$ end of this molecule? Locate the major and minor grooves. Is this a right- or lefthanded helix?
(b) Obtain the file for 145D, a DNA with the Z conformation. Display the molecule as a stick or ball-and-stick structure. Identify the sugar-phosphate backbone for each strand of the DNA duplex. Is this a right- or left-handed helix?
(c) To fully appreciate the secondary structure of DNA, select "Stereo" in the Options menu in the viewer. You will see two images of the DNA molecule. Sit with your nose approximately 10 inches from the monitor and focus on the tip of your nose. In the background you should see three images of the DNA helix. Shift your focus from the tip of your nose to the middle image, which should appear three-dimensional. (Note that only one of the two authors can make this work.) For additional tips, see the Study Guide or the textbook website (www.whfreeman.com/lehninger).

Sana Riaz

Numerade Educator

Problem 1

Problem 2

Problem 3

Problem 4

Problem 5

Problem 6

Problem 7

Problem 8

Problem 9

Problem 10

Problem 11

Problem 12

Problem 13

Problem 14