Principles of Biochemistry

David L. Nelson, Michael M. Cox

Chapter 8

Nucleotides and Nucleic Acids - all with Video Answers

Educators

Chapter Questions

Problem 1

Nucleotide Structure Which positions in the purine ring of a purine nucleotide in DNA have the potential to form hydrogen bonds but are not involved in Watson-Crick base pairing?

Niamat Khuda

Niamat Khuda

Numerade Educator

Problem 2

Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (5')GCGCAATATTTCTCAAAATATTGCGC(3'). Write the base sequence of the complementary strand. What special type of sequence is contained in this DNA segment? Does the double-stranded DNA have the potential to form any alternative structures?

Niamat Khuda

Numerade Educator

Problem 3

DNA of the Human Body Calculate the weight in grams of a double-helical DNA molecule stretching from Earth to the moon $(\sim 320,000 \mathrm{km}) .$ The DNA double helix weighs about $1 \times 10^{-18}$ g per 1,000 nucleotide pairs; each base pair extends 3.4 A. For an interesting comparison, your body contains about 0.5 g of DNA.

Prashant Bana

Numerade Educator

Problem 4

DNA Bending Assume that a poly(A) tract five base pairs long produces a $20^{\circ}$ bend in a DNA strand. Calculate the total (net) bend produced in a DNA if the center base pairs (the third of five) of two successive (dA)s tracts are located (a) 10 base pairs apart; (b) 15 base pairs apart. Assume 10 base pairs per turn in the DNA double helix.

Niamat Khuda

Numerade Educator

Problem 5

Distinction between DNA Structure and RNA Structure Hairpins may form at palindromic sequences in single strands of either RNA or DNA. How is the helical structure of a long and fully base-paired (except at the end) hairpin in RNA different from that of a similar hairpin in DNA?

Niamat Khuda

Numerade Educator

Problem 6

Nucleotide Chemistry The cells of many eukaryotic organisms have highly specialized systems that specifically repair G-T mismatches in DNA. The mismatch is repaired to form a G=C (not $A=T$ ) base pair. This G-T mismatch repair mechanism occurs in addition to a

Niamat Khuda

Numerade Educator

Problem 7

Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperature $\left(t_{\mathrm{m}}\right)$ of 59 "C. If an RNA duplex oligonucleotide of identical sequence (substituting U for T) is constructed, will its melting temperature be higher or lower?

Niamat Khuda

Numerade Educator

Problem 8

Spontaneous DNA Damage Hydrolysis of the $N$ -glycosyl bond between deoxyribose and a purine in DNA creates an AP site. An AP site generates a thermodynamic destabilization greater than that created by any DNA mismatched base pair. This effect is not completely understood. Examine the structure of an AP site (see Fig. $8-29 b$ ) and describe some chemical consequences of base loss.

Shazia Naz

Numerade Educator

Problem 9

Prediction of Nucleic Acid Structure from Its Sequence A part of a sequenced chromosome has the sequence ATTGCATCCGCGCGTGCGCGCGCGATCCCGTTACTTTCCG. Which part of this sequence is most likely to take up the Z conformation?

Niamat Khuda

Numerade Educator

Problem 10

Nucleic Acid Structure Explain why the absorption of UV light by double-stranded DNA increases (the hyperchromic effect) when the DNA is denatured.

Niamat Khuda

Numerade Educator

Problem 11

Determination of Protein Concentration in a Solution Containing Proteins and Nucleic Acids The concentration of protein or nucleic acid in a solution containing both can be estimated by using their different light absorption properties: proteins absorb most strongly at $280 \mathrm{nm}$ and nucleic acids at $260 \mathrm{nm} .$ Estimates of their respective concentrations in a mixture can be made by measuring the absorbance $(A)$ of the solution at 280 and $260 \mathrm{nm}$ and using the table below, which gives $R_{280 / 260},$ the ratio of absorbance s at 280 and $260 \mathrm{nm}$; the percentage of total mass that is nucleic acid; and a factor, $F$, that corrects the $A_{280}$ reading and gives a more accurate protein estimate. The protein concentration (in $\mathrm{mg} / \mathrm{mL}$ ) $=F \times A_{280}$ (assuming the cuvette is 1 $\mathrm{cm}$ wide). Calculate the protein concentration in a solution of $A_{780}=0.69$ and $A_{260}=0.94$
(TABLE CANNOT COPY)

Niamat Khuda

Numerade Educator

Problem 12

Solubility of the Components of DNA Draw the following structures and rate their relative solubilities in water (most soluble to least soluble): deoxyribose, guanine, phosphate. How are these solubilities consistent with the three-dimensional structure of double-stranded DNA?

Niamat Khuda

Numerade Educator

Problem 12

Solubility of the Components of DNA Draw the following structures and rate their relative solubilities in water (most soluble to least soluble): deoxyribose, guanine, phosphate. How are these solubilities consistent with the three-dimensional structure of double-stranded DNA?

Niamat Khuda

Numerade Educator

Problem 13

Polymerase Chain Reaction One strand of a chromosomal DNA sequence is shown below. An investigator wants to amplify and isolate a DNA fragment defined by the segment shown in red, using the polymerase chain reaction (PCR). Design two PCR primers, each 20 nucleotides long, that can be used to amplify this DNA segment. The final PCR product generated with your primers should include no sequences outside the segment in red.
(EQUATION CANNOT COPY)

Shazia Naz

Numerade Educator

Problem 14

Genomic Sequencing In large-genome sequencing projects, the initial data usually reveal gaps where no sequence information has been obtained. To close the gaps, DNA primers complementary to the $5^{\prime}$ -ending strand (that is, identical to the sequence of the $3^{\prime}$ ending strand) at the end of each config are especially useful. Explain how these primers might be used.

Shazia Naz

Numerade Educator

Problem 15

Next-Generation Sequencing In reversible terminator sequencing, how would the sequencing process be affected if the $3^{\prime}$ -end-blocking group of each nucleotide were replaced with the $3^{\prime}-\mathrm{H}$ present in the dideoxynucleotides used in Sanger sequencing?

Shazia Naz

Numerade Educator

Problem 16

Sanger Sequencing Logic In the Sanger (dideoxy) method for DNA sequencing, a small amount of a dideoxynucleoside triphosphate-say, ddCTP-is added to the sequencing reaction along with a larger amount of the corresponding dCTP. What result would be observed if the dCTP were omitted?

Niamat Khuda

Numerade Educator

Problem 17

DNA Sequencing The following DNA fragment was sequenced by the Sanger method. The red asterisk indicates a fluorescent label.
(EQUATION CANNOT COPY)
A sample of the DNA was reacted with DNA polymerase and each of the nucleotide mixtures (in an appropriate buffer) listed below. Dideoxynucleotides (ddNTPs) were added in relatively small amounts.
1. dATP, dTTP, dCTP, dGTP, ddTTP
2. dATP, dTTP, dCTP, dGTP, ddGTP
3. dATP, dCTP, dGTP, ddTTP
4. dATP, dTTP, dCTP, dGTP
The resulting DNA was separated by electrophoresis on an agarose gel, and the fluorescent bands on the gel were located. The band pattern resulting from nucleotide mixture 1 is shown below. Assuming that all mixtures were run on the same gel, what did the remaining lanes of the gel look like?
(FIGURE CANNOT COPY)

Rabeya Zahid

Numerade Educator

Problem 18

Snake Venom Phosphodiesterase An exonuclease is an enzyme that sequentially cleaves nucleotides from the end of a polynucleotide strand. Snake venom phosphodiesterase, which hydrolyzes nucleotides from the 3 ' end of any oligonucleotide with a free $3^{\prime}$ -hydroxyl group, cleaves between the $3^{\prime}$ hydroxyl of the ribose or deoxyribose and the phosphoryl group of the next nucleotide. It acts on single-stranded DNA or RNA and has no base specificity. This enzyme was used in sequence determination experiments before the development of modern nucleic acid sequencing techniques. What are the products of partial digestion by snake venom phosphodiesterase of an oligonucleotide with the sequence (5')GCGCCAUUGC(3') OH?

Niamat Khuda

Numerade Educator

Problem 19

conducive to active cell metabolism. The soil bacterium Bacillus subtilis, for example, begins the process of sporulation when one or more nutrients are depleted. The end product is a small, metabolically dormant structure that can survive almost indefinitely with no detectable metabolism. Spores have mechanisms to prevent accumulation of potentially lethal mutations in their DNA over periods of dormancy that can exceed 1,000 years. $B$. subtilis spores are much more resistant than are the organism's growing cells to heat, UV radiation, and oxidizing agents, all of which promote mutations.
(a) One factor that prevents potential DNA damage in spores is their greatly decreased water content. How would this affect some types of mutations?
(b) Endospores have a category of proteins called small acid-soluble proteins (SASPs) that bind to their DNA, preventing formation of cyclobutane-type dimers. What causes cyclobutane dimers, and why do bacterial endospores need mechanisms to prevent their formation?

Sana Riaz

Numerade Educator

Problem 20

Oligonucleotide Synthesis In the scheme of Figure $8-34,$ each new base to be added to the growing oligonucleotide is modified so that its $3^{\prime}$ hydroxyl is activated and the $5^{\prime}$ hydroxyl has a dimethoxytrityl (DMT) group attached. What is the function of the DMT group on the incoming base?

Niamat Khuda

Numerade Educator

Problem 21

The Structure of DNA Elucidation of the three-dimensional structure of DNA helped researchers understand how this molecule conveys information that can be faithfully replicated from one generation to the next. To see the secondary structure of doublestranded DNA, go to the Protein Data Bank website (www.pdb.org). Use the PDB identifiers listed below to retrieve the structure summaries for the two forms of DNA. View the 3D structure using JSmol (click the 3D View tab or the JSmol link in the Structure Image window on the summary page). You will need to use both the display menus on the screen and the scripting controls in the JSmol menu (accessed by clicking on the JSmol logo in the lower right corner of the image screen) to complete the following exercises. Refer to the JSmol help links as needed.
(a) Access PDB ID $141 \mathrm{D}$, a highly conserved, repeated DNA sequence from the end of the genome of HIV-1 (the virus that causes AIDS). Set the Style to Ball and Stick. Then use the scripting controls to color by element (Color $>$ Atoms $>$ By Scheme $>$ Element (CPK)). Identify the sugar-phosphate backbone for each strand of the DNA duplex. Locate and identify individual bases. Identify the $5^{\prime}$ end of each strand. Locate the major and minor grooves. Is this a right- or left-handed helix?
(b) Access PDB ID $145 \mathrm{D}$, a DNA with the $\mathrm{Z}$ conformation. Set the Style to Ball and Stick. Then use the scripting controls to color by element (Main Menu $>$ Color $>$ Atoms $>$
By Scheme $>$ Element (CPK)). Identify the sugar-phosphate backbone for each strand of the DNA duplex. Is this a right- or left-handed helix?
(c) To fully appreciate the secondary structure of DNA, view the molecules in stereo. From the scripting control Main Menu select Style $>$ Stereographic $>$ Cross-eyed viewing or Wall-eyed viewing. (If you have stereographic glasses available, select the appropriate option.) You will see two images of the DNA molecule. Sit with your nose approximately 10 inches from the monitor and focus on the tip of your nose (cross-eyed) or on the opposite edges of the screen (wall-eyed). In the background you should see three images of the DNA helix. Shift your focus to the middle image, which should appear three dimensional. (Note that only one of the two authors can make this work.)

Sana Riaz

Numerade Educator

Problem 22

Chargaff's Studies of DNA Structure The chapter section "DNA Is a Double Helix That Stores Genetic Information" includes a summary of the main findings of Erwin Chargaff and his coworkers, listed as four conclusions ("Chargaff's rules"; p. 286). In this problem, you will examine the data Chargaff collected in support of these conclusions. In one paper, Chargaff (1950) described his analytical methods and some early results. Briefly, he treated DNA samples with acid to remove the bases, separated the bases by paper chromatography, and measured the amount of each base with UV spectroscopy. His results are shown in the three tables below. The molar ratio is the ratio of the number of moles of each base in the sample to the number of moles of phosphate in the sample - this gives the fraction of the total number of bases represented by each particular base. The recovery is the sum of all four bases (the sum of the molar ratios); full recovery of all bases in the DNA would give a recovery of $1.0 .$
(TABLES CANNOT COPY)
(a) Based on these data, Chargaff concluded that "no differences in composition have so far been found in DNA from different tissues of the same species." This corresponds to conclusion 2 in this chapter. However, a skeptic looking at the data above might say, "They certainly look different to me!" If you were Chargaff, how would you use the data to convince the skeptic to change her mind?
(b) The base composition of DNA from normal and cancerous liver cells (hepatocarcinoma) was not distinguishably different. Would you expect Chargaff's technique to be capable of detecting a difference between the DNA of normal and cancerous cells? Explain your reasoning.
As you might expect, Chargaff's data were not completely convincing. He went on to improve his techniques, as described in his 1951 paper, in which he reported molar ratios of bases in DNA from a variety of organisms.
(TABLE CANNOT COPY)
(c) According to Chargaff, as stated in conclusion 1 in this chapter, "The base composition of DNA generally varies from one species to another." Provide an argument, based on the data presented so far, that supports this conclusion.
(d) According to conclusion $4,$ "In all cellular DNAs, regardless of the species, $\dots$ A $+$ $\mathrm{G}=\mathrm{T}+\mathrm{C} \cdot "$ Provide an argument, based on the data presented so far, that supports this conclusion.
Part of Chargaff's intent was to disprove the "tetranucleotide hypothesis"; this was the idea that DNA was a monotonous tetranucleotide polymer (AGCT) $_{n}$ and therefore not capable of containing sequence information. Although the data presented above show that DNA cannot be simply a repeating tetranucleotide - if so, all samples would have molar ratios of 0.25 for each base $-$ it was still possible that the DNA from different organisms was a slightly more complex, but still monotonous, repeating sequence.
To address this issue, Chargaff took DNA from wheat germ and treated it with the enzyme deoxyribonuclease for different time intervals. At each time interval, some of the DNA was converted to small fragments; the remaining, larger fragments he called the "core." In the table below, the "19\% core" corresponds to the larger fragments left behind when $81 \%$ of the DNA was degraded; the "8\% core" corresponds to the larger fragments left after $92 \%$ degradation.
(TABLE CANNOT COPY)
(e) How would you use these data to argue that wheat germ DNA is not a monotonous repeating sequence?

Sana Riaz

Numerade Educator