• Home
  • Textbooks
  • Lehninger Principles of Biochemistry
  • Protein Metabolism

Lehninger Principles of Biochemistry

David L. Nelson, Michael M. Cox

Chapter 27

Protein Metabolism - all with Video Answers

Educators


Chapter Questions

05:40

Problem 1

Messenger RNA Translation Predict the amino acid sequences of peptides formed by ribosomes in response to the following mRNA sequences, assuming that the reading frame begins with the first three bases in each sequence.
(a) GGUCAGUCGCUCCUGAUU
(b) UUGGAUGCGCCAUAAUUUGCU
(c) CAUGAUGCCUGUUGCUAC
(d) AUGGACGAA

Jennifer Hudspeth
Jennifer Hudspeth
Numerade Educator
09:14

Problem 2

How Many Different mRNA Sequences Can Specify One Amino Acid Sequence?
Write all the possible mRNA sequences that can code for the simple tripeptide segment Leu-Met-Tyr. Your answer will give you some idea of the number of possible mRNAs that can code for one polypeptide.

Pronoy Sinha
Pronoy Sinha
Numerade Educator
01:37

Problem 3

Can the Base Sequence of an mRNA Be Predicted from the Amino Acid Sequence of Its Polypeptide Product? A given sequence of bases in an mRNA will code for one and only one sequence of amino acids in a polypeptide, if the reading frame is specified. From
a given sequence of amino acid residues in a protein such as cytochrome $c,$ can we predict the base sequence of the unique mRNA that encoded it? Give reasons for your answer.

Pronoy Sinha
Pronoy Sinha
Numerade Educator
08:36

Problem 4

Coding of a Polypeptide by Duplex DNA The template strand of a segment of double-helical DNA contains the sequence (5')CTTAACACCCCTGACTTCGCGCCGTCG(3')
(a) What is the base sequence of the mRNA that can be transcribed from this strand?
(b) What amino acid sequence could be coded by the mRNA in (a), starting from the $5^{\prime}$ end?
(c) If the complementary (nontemplate) strand of this DNA were transcribed and translated, would the resulting amino acid sequence be the same as in (b)? Explain the biological significance of your answer.

Eric Tran
Eric Tran
Numerade Educator
04:52

Problem 5

Methionine Has Only One Codon Methionine is one of two amino acids with only one codon. How does the single codon for methionine specify both the initiating residue and interior Met residues of polypeptides synthesized by $E$ coli?

Pronoy Sinha
Pronoy Sinha
Numerade Educator
02:17

Problem 6

The Genetic Code in Action Translate the following mRNA, starting at the first $5^{\prime}$ nucleotide, assuming that translation occurs in an $E$. coli cell. If all tRNAs make maximum use of wobble rules but do not contain inosine, how many distinct tRNAs are required to translate this RNA? (5')AUGGGUCGUGAGUCAUCGUUAAUUG UAGCUGGAGGGGAGGAAUGA(3')

Sana Riaz
Sana Riaz
Numerade Educator
02:49

Problem 7

Synthetic mRNAs The genetic code was elucidated through the use of polyribonucleotides synthesized either enzymatically or chemically in the laboratory. Given what we now know about the genetic code, how would you make a polyribonucleotide that could serve as an mRNA coding predominantly for many Phe residues and a small number of Leu and Ser residues? What other amino acid(s) would be encoded by this polyribonucleotide, but in smaller amounts?

Lottie Adams
Lottie Adams
Numerade Educator
07:03

Problem 8

Energy cost of Protein Biosynthesis Determine the minimum energy cost, in terms of ATP equivalents expended, for the biosynthesis of the $\beta$ -globin chain of hemoglobin (146 residues), starting from a pool including all necessary amino acids, ATP, and GTP. Compare your answer with the direct energy cost of the biosynthesis of a linear glycogen chain of 146 glucose residues in $(\alpha 1 \rightarrow 4)$ linkage, starting from a pool including glucose, UTP, and ATP (Chapter 15). From your data, what is the extra energy cost of making a protein, in which all the residues are ordered in a specific sequence, compared with the cost of making a polysaccharide containing the same number of residues but lacking the informational content of the protein?
In addition to the direct energy cost for the synthesis of a protein, there are indirect energy costs-those required for the cell to make the necessary enzymes for protein synthesis. Compare the magnitude of the indirect costs to a eukaryotic cell of the biosynthesis of linear $(\alpha 1 \rightarrow 4)$ glycogen chains and the biosynthesis of polypeptides, in terms of the enzymatic machinery involved.

Rashmi Sinha
Rashmi Sinha
Numerade Educator
08:20

Problem 9

Predicting Anticodons from Codons Most amino acids have more than one codon and attach to more than one tRNA, each with a different anticodon. Write all possible anticodons for the four codons of glycine: $\left(5^{\prime}\right) \mathrm{GGU}, \mathrm{GGC}, \mathrm{GGA},$ and GGG.
(a) From your answer, which of the positions in the anticodons are primary determinants of their codon specificity in the case of glycine?
(b) Which of these anticodon-codon pairings has/have a wobbly base pair?
(c) In which of the anticodon-codon pairings do all three positions exhibit strong Watson-Crick hydrogen bonding?

Sana Riaz
Sana Riaz
Numerade Educator
10:35

Problem 10

Effect of single-Base Changes on Amino Acid Sequence Much important confirmatory evidence on the genetic code has come from assessing changes in the amino acid sequence of mutant proteins after a single base has been changed in the gene that encodes the protein. Which of the following amino acid replacements would be consistent with the genetic code if the replacements were caused by a single base change? Which cannot be the result of a single-base mutation? Why?
(a) Phe $\rightarrow$ Leu
(b) Lys $\rightarrow$ Ala
(c) Ala $\rightarrow$ Thr
(d) Phe $\rightarrow$ Lys
(e) Ile $\rightarrow$ Leu
(f) His $\rightarrow$ Glu
$(g)$ Pro $\rightarrow$ Ser

Bryan Valdivia
Bryan Valdivia
Numerade Educator
04:36

Problem 11

Resistance of the Genetic Code to Mutation The following RNA sequence represents the beginning of an open reading frame. What changes (if any) can occur at each position without generating a change in the encoded amino acid residue? (5')AUGAUAUUGCUAUCUUGGACU

Pronoy Sinha
Pronoy Sinha
Numerade Educator
02:18

Problem 12

Basis of the Sickle Cell Mutation Sickle cell hemoglobin has a Val residue at position 6 of the $\beta$ -globin chain instead of the Glu residue found in normal hemoglobin A. Can you predict what change took place in the DNA codon for glutamate to account for replacement of the Glu residue by Val?

Pronoy Sinha
Pronoy Sinha
Numerade Educator
02:34

Problem 13

Proofreading by Aminoacyl-tRNA Synthetases The isoleucyl-tRNA synthetase has a proofreading function that ensures the fidelity of the aminoacylation reaction, but the histidyl-tRNA synthetase lacks such a proofreading function. Explain.

Sana Riaz
Sana Riaz
Numerade Educator
04:10

Problem 14

Importance of the "Second Genetic Code" Some aminoacyl-tRNA synthetases do not recognize and bind the anticodon of their cognate tRNAs but instead use other structural features of the tRNAs to impart binding specificity. The tRNAs for alanine apparently fall into this category.
(a) What features of tRNA Ala are recognized by Ala-tRNA synthetase?
(b) Describe the consequences of a $\mathrm{C} \rightarrow \mathrm{G}$ mutation in the third position of the anticodon of tRNA $^{\text {Ala }}$
(c) What other kinds of mutations might have similar effects?
(d) Mutations of these types are never found in natural populations of organisms. Why?
(Hint: Consider what might happen both to individual proteins and to the organism as a whole.

Sana Riaz
Sana Riaz
Numerade Educator
02:27

Problem 15

Rate of Protein Synthesis A bacterial ribosome can synthesize about 20 peptide bonds per minute. If the average bacterial protein is approximately 260 amino acid residues long, how many proteins can the ribosomes in an $E$. coli cell synthesize in 20 minutes if all ribosomes are functioning at maximum rates?

Dominique Jan Tan
Dominique Jan Tan
Numerade Educator
02:24

Problem 16

The Role of Translation Factors A researcher isolates mutant variants of the bacterial translation factors IF2, EF-Tu, and EF-G. In each case, the mutation allows proper folding of the protein and the binding of GTP but does not allow GTP hydrolysis. At what stage would translation be blocked by each mutant protein?

Sana Riaz
Sana Riaz
Numerade Educator
05:12

Problem 17

Maintaining the Fidelity of Protein Synthesis The chemical mechanisms used to avoid errors in protein synthesis are different from those used during DNA replication. DNA polymerases use a $3^{\prime} \rightarrow 5^{\prime}$ exonuclease proofreading activity to remove mispaired nucleotides incorrectly inserted into a growing DNA strand. There is no analogous proofreading function on ribosomes, and, in fact, the identity of an amino acid attached to an incoming tRNA and added to the growing polypeptide is never checked. A proofreading step that hydrolyzed the previously formed peptide bond after insertion of an incorrect amino acid into a growing polypeptide (analogous to the proofreading step of DNA polymerases) would be impractical. Why? (Hint: Consider how the link between the growing polypeptide and the mRNA is maintained during elongation; see Figs $27-29$ and $27-30 .)$

Sana Riaz
Sana Riaz
Numerade Educator
02:21

Problem 18

Ribosome Profiling In the ribosome profiling method (Fig. $27-37$ ), segments of mRNA that are bound to and protected by ribosomes are isolated and converted into DNA for sequencing. However, the mRNA segments are usually only part of the overall RNA protected by ribosomes and isolated after ribonuclease treatment. What other RNA species would be isolated by this protocol?

Sana Riaz
Sana Riaz
Numerade Educator
02:41

Problem 19

Predicting the Cellular Location of a Protein The gene for a eukaryotic polypeptide 300 amino acid residues long is altered so that a signal sequence recognized by SRP occurs at the polypeptide's amino terminus and a nuclear localization signal (NLS) occurs internally, beginning at residue $150 .$ Where is the protein likely to be found in the cell?

Rashmi Gondi
Rashmi Gondi
Numerade Educator
03:39

Problem 20

Requirements for Protein Translocation across a Membrane The secreted bacterial protein OmpA has a precursor, ProOmpA, which has the amino-terminal signal sequence required for secretion. If purified ProOmpA is denatured with 8 M urea and the urea is then removed (such as by running the protein solution rapidly through a gel filtration column), the protein can be translocated across isolated bacterial inner membranes in vitro. However, translocation becomes impossible if ProOmpA is first allowed to incubate for a few hours in the absence of urea. Furthermore, the capacity for translocation is maintained for an extended period if ProOmpA is first incubated in the presence of another bacterial protein called trigger factor. Describe the probable function of this factor.

Sana Riaz
Sana Riaz
Numerade Educator
02:26

Problem 21

Protein-Coding Capacity of a Viral DNA The 5,386 bp genome of bacteriophage $\phi \mathrm{X} 174$ includes genes for 10 proteins, designated $\mathrm{A}$ to $\mathrm{K}$ (omitting $^{*} \mathrm{I}^{\prime \prime}$ ), with sizes given in the table below. How much DNA would be required to encode these 10 proteins? How can you reconcile the size of the $\phi \mathrm{X} 174$ genome with its protein-coding capacity?

Sana Riaz
Sana Riaz
Numerade Educator
04:41

Problem 22

Designing Proteins by Using Randomly Generated Genes Studies of the amino acid sequence and corresponding three-dimensional structure of wild-type or mutant proteins have led to significant insights into the principles that govern protein folding. An important test of this understanding would be to design a protein based on these principles and see whether it folds as expected.
Kamtekar and colleagues (1993) used aspects of the genetic code to generate random protein sequences with defined patterns of hydrophilic and hydrophobic residues. Their clever approach combined knowledge about protein structure, amino acid properties, and the genetic code to explore the factors that influence protein structure.
The researchers set out to generate a set of proteins with the simple four-helix bundle structure shown below, with $\alpha$ helices (shown as cylinders) connected by segments of random coil (light red).
Each $\alpha$ helix is amphipathic-the $R$ groups on one side of the helix are exclusively hydrophobic (yellow), and those on the other side are exclusively hydrophilic (blue). A protein consisting of four of these helices separated by short segments of random coil would be expected to fold so that the hydrophilic sides of the helices face the solvent.
(a) What forces or interactions hold the four $\alpha$ helices together in this bundled structure?
Figure $4-4$ a shows a segment of $\alpha$ helix consisting of 10 amino acid residues. With the gray central rod as a divider, four of the $R$ groups (purple spheres) extend from the left side of the helix, and six extend from the right.
(b) Number the $R$ groups in Figure $4-4 a,$ from top (amino terminus; 1 ) to bottom (carboxyl terminus; 10 ). Which $R$ groups extend from the left side and which from the right?
(c) Suppose you wanted to design this 10 amino acid segment to be an amphipathic helix, with the left side hydrophilic and the right side hydrophobic. Give a sequence of 10 amino acids that could potentially fold into such a structure. There are many possible correct answers.
(d) Give one possible double-stranded DNA sequence that could encode the amino acid sequence you chose for (c). (It is an internal portion of a protein, so you do not need to include start or stop codons.)
Rather than designing proteins with specific sequences, Kamtekar and colleagues designed proteins with partially random sequences, with hydrophilic and hydrophobic amino acid residues placed in a controlled pattern. They did this by taking advantage of some interesting features of the genetic code to construct a library of synthetic DNA molecules with partially random sequences arranged in a particular pattern.
To design a DNA sequence that would encode random hydrophobic amino acid sequences, the researchers began with the degenerate codon NTN, where $\mathrm{N}$ can be $\mathrm{A}, \mathrm{G}, \mathrm{C}$ or T. They filled each N position by including an equimolar mixture of $\mathrm{A}, \mathrm{G}, \mathrm{C},$ and $\mathrm{T}$ in the DNA synthesis reaction to generate a mixture of DNA molecules with different nucleotides at that position (see Fig. $8-32$ ). Similarly, to encode random polar amino acid sequences, they began with the degenerate codon NAN and used an equimolar mixture of A, $G,$ and $C$ (but in this case, no
T) to fill the N positions. (e) Which amino acids can be encoded by the NTN triplet? Are all amino acids in this set hydrophobic? Does the set include all the hydrophobic amino acids?
(f) Which amino acids can be encoded by the NAN triplet? Are all of these polar? Does the set include all the polar amino acids?
(g) In creating the NAN codons, why was it necessary to leave T out of the reaction mixture?
Kamtekar and coworkers cloned this library of random DNA sequences into plasmids, selected 48 that produced the correct patterning of hydrophilic and hydrophobic amino acids, and expressed these in $E$. coli. The next challenge was to determine whether the proteins folded as expected. It would be very time-consuming to express each protein, crystallize it, and determine its complete three-dimensional structure. Instead, the investigators used the $E$. coli protein-processing machinery to screen out sequences that led to highly defective proteins. In this initial screening, they kept only those clones that resulted in a band of protein with the expected molecular weight on SDS polyacrylamide gel electrophoresis (see Fig. $3-18$ ).
(h) Why would a grossly misfolded protein fail to produce a band of the expected molecular weight on electrophoresis?
Several proteins passed this initial test, and further exploration showed that they had the expected four-helix structure.
(i) Why didn't all of the random-sequence proteins that passed the initial screening test produce four-helix structures?

Sana Riaz
Sana Riaz
Numerade Educator