Fundamentals of Biochemistry

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Chapter 27

Protein Synthesis - all with Video Answers

Educators

Chapter Questions

Problem 1

Could a single nucleotide deletion restore the function of a protein-coding gene interrupted by the insertion of a 4 -nt sequence? Explain.

Amruta Pandit

Amruta Pandit

Numerade Educator

Problem 2

When a sequence of deoxynucleotides is entered into a translation program (such as the ExPASy Translate tool at http://web.expasy.org/ translate $/$ ), six possible polypeptide sequences are given as results. Explain.

Shazia Naz

Numerade Educator

Problem 3

List all possible codons present in a ribonucleotide polymer containing $\mathrm{U}$ and $\mathrm{G}$ in random sequence. Which amino acids are encoded by this RNA?

Aadit Sharma

Numerade Educator

Problem 4

Which amino acids are specified by codons that can be changed to a UAG Stop codon by a single point mutation?

Aadit Sharma

Numerade Educator

Problem 5

In the genetic code used by mitochondria in many species, UGA codes for tryptophan rather than a Stop signal. How does mitochondrial translation terminate?

Shazia Naz

Numerade Educator

Problem 6

Some mitochondria use a second codon, in addition to AUG, to specify Met. Which codon(s) is (are) most likely to be used this way?

Shazia Naz

Numerade Educator

Problem 7

The protein Xpot transports tRNAs out of the nucleus so that they can be aminoacylated in the cytosol.
(a) What tRNA structural features is Xpot likely to recognize?
(b) How does Xpot distinguish mature tRNAs from pre-tRNAs?

Shazia Naz

Numerade Educator

Problem 8

The enzyme thiouridylase converts certain tRNA uridine residues to 2-thiouridine. Draw the structure of this modified nucleotide.

Shazia Naz

Numerade Educator

Problem 9

IleRS uses a double-sieve mechanism to accurately produce Ile-tRNA $^{\text {Ile }}$ and prevent the synthesis of Val-tRNA $^{\text {Ile }}$ Which other pairs of amino acids differ in structure by a single carbon and might have aaRSs that use a similar double-sieve proofreading mechanism?

Aadit Sharma

Numerade Educator

Problem 10

Some mutations that do not alter the identity of the encoded amino acid lead to diminished production of the protein. How does the mutation affect translation?

Shazia Naz

Numerade Educator

Problem 11

Draw the structures of an I?C wobble pair and an I?U wobble pair.

Aadit Sharma

Numerade Educator

Problem 12

In eukaryotes, the primary rRNA transcript is a $45 \mathrm{S}$ rRNA that in cludes the sequences of the $18 \mathrm{S}, 5.8 \mathrm{S}$, and $28 \mathrm{S}$ rRNAs separated by short spacers. What is the advantage of this operon-like arrangement of rRNA genes?

Shazia Naz

Numerade Educator

Problem 13

Explain the significance of the observation that peptides such as fMet-Leu-Phe "activate" the phagocytotic (particle-engulfing) functions of mammalian leukocytes (white blood cells).

Shazia Naz

Numerade Educator

Problem 14

Explain why prokaryotic ribosomes can translate a circular mRNA molecule, whereas eukaryotic ribosomes normally cannot, even in the presence of the required cofactors.

Shazia Naz

Numerade Educator

Problem 15

Explain why the translation of a given mRNA can be inhibited by a segment of its complementary sequence, a so-called antisense RNA.

Shazia Naz

Numerade Educator

Problem 16

Eukaryotic initiation factor eIF2B is a guanine nucleotide exchange factor. Explain why eIF2B would enhance the activity of eIF2.

Aadit Sharma

Numerade Educator

Problem 17

The ribosome can transfer any peptidyl group from the P-site tRNA to any aminoacyl group on the A-site RNA, but the rate may vary with the identities of those groups. Propose an explanation why the ribosome synthesizes poly-Pro sequences extremely slowly compared to other peptide sequences.

Shazia Naz

Numerade Educator

Problem 18

Mitochondrial ribosomes manufacture 13 proteins, all of which are components of the oxidative phosphorylation machinery. Propose an explanation why the peptide exit tunnel of the mitoribosome is lined with hydrophobic groups rather than hydrophilic groups, as in a cytosplasmic ribosome.

Shazia Naz

Numerade Educator

Problem 19

Cells can make certain oligopeptides using conventional enzymes rather than mRNA-directed translation by a ribosome. Draw the product of the reaction catalyzed by L-glutamate: L-cysteine gamma-ligase ( $\gamma$ -glutamylcysteine synthetase).

Shazia Naz

Numerade Educator

Problem 20

The peptidyl transferase activity of the ribosome does not require an additional source of free energy. Is the reaction catalyzed by $\gamma$ -glutamylcysteine synthetase (Problem 19) also exergonic?

Shazia Naz

Numerade Educator

Problem 21

One cause of the neurodegenerative disease amyotropic lateral sclerosis (ALS) is the expansion of the repeating hexanucleotide sequence GGGGCC in the noncoding region of a gene. By unknown mechanisms, the repeating sequence is translated to generate neurotoxic peptides. Predict the sequences of the possible repeating dipeptides.

Aadit Sharma

Numerade Educator

Problem 22

The flu virus maximizes the use of its limited $(13.5 \mathrm{kb})$ genome by using alternative translation initiation sites, overlapping reading frames, and ribosomal frameshifting. For example, part of the viral PA gene includes a rarely used CGU codon. When the ribosome pauses to translate this codon, it may slip ahead by one nucleotide and produce a polypeptide with a different C-terminal sequence. From the partial mRNA sequence shown here, determine the normal polypeptide sequence and the sequence with the frameshift. - GAUUCCUUUCGUCAGUCCGAGA -

Aadit Sharma

Numerade Educator

Problem 23

A double-stranded fragment of viral DNA, one of whose strands is shown below, encodes two peptides, called vir- 1 and vir - 2 . Adding this double-stranded DNA fragment to an in vitro transcription and translation system yields peptides of 10 residues $(\text {vir}-1)$ and 5 residues $(\text {vir}-2)$ AGATCGGATGCTCAACTATATGTGATTAACAGAGCATGCGGCATAAACT
(a) Identify the DNA sequence that encodes each peptide.
(b) Determine the amino acid sequence of each peptide.
(c) In a mutant viral strain, the $T$ at position 23 has been replaced with G. Determine the amino acid sequences of the two peptides encoded by the mutant virus.

Rabeya Zahid

Numerade Educator

Problem 24

The sequence of the sense strand of a mammalian gene is TATAATACGCGCAATACAATCTACAGCTTCGCGTAAATCGTAGGTAAGTTGTAATAAATATAAGTGAGTATGATACAGGCTTTGGACCGATAGATGCGACCCTGGAGGTAAGTATAGATTAATTAAGCACAGGCATGCAGGGATATCCTCCAAAAAGGTAAGTAACCTTACGGTCAATTAATTCAGGCAGTAGATGAATAAACGATATCGATCGGTTAGGTAAGTCTGAT Determine the sequences of the mature RNA and the encoded protein. Assume that transcription initiates at a G approximately 25 bp downstream of the TATAATA sequence, that each $5^{\prime}$ splice site has the sequence AG/GUAAGU, and that each $3^{\prime}$ splice site has the sequence CAG/G (where / marks the location of the splice).

Aadit Sharma

Numerade Educator

Problem 25

EF-Tu binds all aminoacyl-tRNAs with approximately equal affinity so that it can deliver them to the ribosome with the same efficiency. Based on the experimentally determined binding constants for EF-Tu and correctly charged and mischarged aminoacyl-tRNAs (see table), explain how the tRNA-EF-Tu recognition system could prevent the incorporation of the wrong amino acid during translation.

Rabeya Zahid

Numerade Educator

Problem 26

The antibiotic paromomycin binds to a ribosome and induces the same conformational changes in $16 \mathrm{S}$ rRNA residues $\mathrm{A} 1492$ and $\mathrm{A} 1493$ as are induced by codon-anticodon pairing (Fig. $27-32$ ). Propose an explanation for the antibiotic effect of paromomycin.

Aadit Sharma

Numerade Educator

Problem 27

The rate of the peptidyl transferase reaction increases as the pH increases from 6 to 8. Explain these results in terms of its reaction mechanism.

Shazia Naz

Numerade Educator

Problem 28

It has been proposed that residue $A 2486$ is protonated and therefore stabilizes the tetrahedral reaction intermediate. Is this mechanistic embellishment consistent with the observed pH effect (Problem 27 )? Explain.

Shazia Naz

Numerade Educator

Problem 29

Explain why a minimum of 32 tRNAs are required to translate the "standard" genetic code.

Shazia Naz

Numerade Educator

Problem 30

Under conditions of nutrient starvation, bacteria produce a protein that binds to the $3^{\prime}$ end of 16 S rRNA. What is the result of this interaction and why is it beneficial to the cell?

Shazia Naz

Numerade Educator

Problem 31

All cells contain an enzyme called peptidyl-tRNA hydrolase, and cells that are deficient in the enzyme grow very slowly. What is the probable function of the enzyme and why is it necessary?

Shazia Naz

Numerade Educator

Problem 32

Genetically engineered mRNAs that code for a stretch of basic residues, such as poly(Lys), induce translation termination and destruction of the nascent polypeptide. Explain how this response would protect cells from the effect of faulty transcription that produces mRNAs with mutated Stop codons.

Shazia Naz

Numerade Educator

Problem 33

Calculate the energy required, in ATP equivalents, to synthesize a 100-residue protein from free amino acids in $E .$ coli (assume that the Nterminal Met remains attached to the polypeptide and that no ribosomal proofreading occurs)

Aadit Sharma

Numerade Educator

Problem 34

Design an mRNA with the necessary prokaryotic control sites that codes for the octapeptide Lys-Pro-Ala-Gly-Thr-Glu-Asn-Ser.

Aadit Sharma

Numerade Educator

Problem 35

How many different types of macromolecules must be minimally contained in a cell-free protein synthesizing system from $E .$ coli? Count each type of ribosomal component as a different macromolecule.

Shazia Naz

Numerade Educator

Problem 36

An antibiotic named fixmycin, which you have isolated from a fungus growing on ripe passion fruit, is effective in curing several types of sexually transmitted diseases. In characterizing fixmycin's mode of action, you have found that it is a bacterial translational inhibitor that binds exclusively to the large subunit of $E .$ coli ribosomes. The initiation of protein synthesis in the presence of fixmycin results in the generation of dipeptides that remain associated with the ribosome. Suggest a mechanism of fixmycin action.

Shazia Naz

Numerade Educator