Biochemistry

Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto, Jr, Lubert Stryer

Chapter 29

RNA Synthesis and Processing - all with Video Answers

Educators

Chapter Questions

Problem 1

The sequence of part of an mRNA is 5 '-AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG-3' What is the sequence of the DNA coding strand? Of the DNA template strand?

Alexander Clippinger

Alexander Clippinger

Numerade Educator

Problem 2

Why is RNA synthesis not as carefully monitored for errors as is DNA synthesis?

Alexander Clippinger

Alexander Clippinger

Numerade Educator

Problem 3

Why is it advantageous for DNA synthesis to be more rapid than RNA synthesis?

Alexander Clippinger

Alexander Clippinger

Numerade Educator

Problem 4

The overall structures of RNA polymerase and DNA polymerase are very different, yet their active sites show considerable similarities. What do the similarities suggest about the evolutionary relationship between these two important enzymes?

Alexander Clippinger

Alexander Clippinger

Numerade Educator

Problem 5

Heparin inhibits transcription by binding to RNA polymerase. What properties of heparin allow it to bind so effectively to RNA polymerase?

Alexander Clippinger

Alexander Clippinger

Numerade Educator

Problem 6

Sigma protein by itself does not bind to promoter sites. Predict the effect of a mutation enabling $\sigma$ to bind to the -10 region in the absence of other subunits of RNA polymerase.

Alexander Clippinger

Alexander Clippinger

Numerade Educator

Problem 7

What would be the likely effect of a mutation that prevents $\sigma$ from dissociating from the RNA polymerase core?

Alexander Clippinger

Alexander Clippinger

Numerade Educator

Problem 8

What is the minimum length of time required for the synthesis by $E .$ coli polymerase of an mRNA encoding a 100 -kDa protein?

Alexander Clippinger

Alexander Clippinger

Numerade Educator

Problem 9

RNA polymerase finds promoter sites very rapidly. The observed rate constant for the binding of the RNA polymerase holoenzyme to promoter sequences is $10^{10} \mathrm{M}^{-1} \mathrm{s}^{-1} .$ The rate constant for two macromolecules encountering each other is typically $10^{8} \mathrm{M}^{-1} \mathrm{s}^{-1}$. Propose an explanation for the 100 -fold larger rate for a protein finding a particular site along a DNA molecule.

Alexander Clippinger

Alexander Clippinger

Numerade Educator

Problem 10

Identify the likely transcription start site in the following DNA sequence:
5'-GCCGTTGACACCGTTCGGCGATCGATCCGCTATAATGTGTGGATCCGCTT-3' $3^{\prime}-$ CGGCAACTGTGGCAAGCCGCTAGCTAGGCGATATTACACACCTAGGCGAA-5'

Alexander Clippinger

Alexander Clippinger

Numerade Educator

Problem 11

How far apart are transcription bubbles on $E .$ coli genes that are being transcribed at a maximal rate?

Mikayla Stephens

Mikayla Stephens

Numerade Educator

Problem 12

Consider the synthetic RNA-DNA transcription bubble illustrated here. Refer to the coding DNA strand, the template strand, and the RNA strand as strands $1,2,$ and $3,$ respectively. (FIGURE CAN'T COPY)
(a) Suppose that strand 3 is labeled with $32 \mathrm{P}$ at its $5^{\prime}$ end and that polyacrylamide gel electrophoresis is carried out under nondenaturing conditions. Predict the autoradiographic pattern for (i) strand 3 alone, (ii) strands 1 and 3 (iii) strands 2 and $3,$ (iv) strands $1,2,$ and $3,$ and $(v)$ strands
$1,2,$ and 3 and core RNA polymerase.
(b) What is the likely effect of rifampicin on RNA synthesis in this system?
(c) Heparin blocks elongation of the RNA primer if it is added to core RNA polymerase before the onset of transcription but not if added after transcription starts. Account for this difference.
(d) Suppose that synthesis is carried out in the presence of ATP, CTP, and UTP. Compare the length of the longest product obtained with that expected when all four ribonucleoside triphosphates are present.

Sana Riaz

Numerade Educator

Problem 13

The major products of proofreading by RNA polymerase are dinucleotides rather than mononucleotides. Why?

Alexander Clippinger

Alexander Clippinger

Numerade Educator

Problem 14

Di-and trinucleotides are occasionally released from RNA polymerase at the very start of transcription, a process called abortive cycling. This process requires the restart of transcription. Suggest a plausible explanation for abortive cycling.

Hailey Tomashek

Hailey Tomashek

Numerade Educator

Problem 15

Cordycepin inhibits poly(A) synthesis at low concentrations and RNA synthesis at higher concentrations. (FIGURE CAN'T COPY)
(a) What is the basis of inhibition by cordycepin?
(b) Why is poly(A) synthesis more sensitive than the synthesis of other RNAs to the presence of cordycepin?
(c) Does cordycepin need to be modified to exert its effect?

Carlene Jimenez

Carlene Jimenez

Numerade Educator

Problem 16

A gene contains eight sites where alternative splicing is possible. Assuming that the splicing pattern at each site is independent of that at all other sites, how many splicing products are possible?

Alexander Clippinger

Alexander Clippinger

Numerade Educator

Problem 17

Negative supercoiling of DNA favors the transcription of genes because it facilitates unwinding. However, not all promoter sites are stimulated by negative supercoiling. The promoter site for topoisomerase II itself is a noteworthy exception. Negative supercoiling decreases the rate of transcription of this gene. Propose a possible mechanism for this effect and suggest a reason why it may occur.

Jennifer Stoner

Jennifer Stoner

Numerade Educator

Problem 18

In one type of mutation leading to a form of thalassemia, the mutation of a single base (G to A) generates a new $3^{\prime}$ splice site (blue in the illustration below) akin to the normal one (yellow) but farther upstream.
Normal 3 ' end of intron
$5^{\prime}$ CCTATTGGTCTATTTTCCACCCTTAGGCTGCTG 3'
5' CCTATTAGTCTATTTTCCACCCTTAGGCTGCTG 3'
What is the amino acid sequence of the extra segment of protein synthesized in a thalassemic patient having a mutation leading to aberrant splicing? The reading frame after the splice site begins with TCT.

Sana Riaz

Numerade Educator

Problem 19

than the normal one. The poly(A) tail of this mutant mRNA was located a few nucleotides after the only AAUAAA sequence in the additional sequence. Propose a mutation that would lead to the production of this altered mRNA.Another thalassemic patient had a mutation leading to the production of an mRNA for the $\beta$ chain of hemoglobin that was 900 nucleotides longer

Ramesh Singh

Numerade Educator

Problem 20

Many uridine molecules are inserted into some mitochondrial mRNAs in trypanosomes. The uridine residues come from the poly(U) tail of a donor strand. Nucleoside triphosphates do not participate in this reaction. Propose a reaction mechanism that accounts for these findings. (Hint: Relate RNA editing to RNA splicing.)

Susan Hallstrom

Susan Hallstrom

Numerade Educator

Problem 21

What processes considered in this chapter make the proteome more complex than the genome? What processes might further enhance this complexity?

Rashmi Sinha

Numerade Educator

Problem 22

Suggest a means by which you could separate $\mathrm{mRNA}$ from the other types of RNA in a eukaryotic cell.

Sam Limsuwannarot

Sam Limsuwannarot

Numerade Educator

Problem 23

Nuclei were isolated from brain, liver, and muscle. The nuclei were then incubated with $\alpha$ $\left[^{32} \mathrm{P}\right] \mathrm{UTP}$ under conditions that allow RNA synthesis, except that an inhibitor of RNA initiation was present. The radioactive RNA was isolated and annealed to various DNA sequences that had been attached to a gene chip. In the adjoining graphs, the intensity of the shading indicates roughly how much mRNA was attached to each DNA sequence. (FIGURE CAN'T COPY)
(a) Why does the intensity of hybridization differ between genes?
(b) What is the significance of the fact that some of the RNA molecules display different hybridization patterns in different tissues?
(c) Some genes are expressed in all three tissues. What would you guess is the nature of these genes?
(d) Suggest a reason why an initiation inhibitor was included in the reaction mixture.

Jenny Wu

Numerade Educator

Problem 24

The adjoining autoradiograph depicts several bacterial genes undergoing transcription. Identify the DNA. What are the strands of increasing length? Where is the beginning of transcription? The end of transcription? On the page, what is the direction of RNA synthesis? What can you conclude about the number of enzymes participating in RNA synthesis on a given gene? (FIGURE CAN'T COPY)

Dennis Howard

Numerade Educator