Chapter 21, Transcription and RNA Processing Video Solutions, Principles of Biochemistry

Problem 1

A bacterial RNA polymerase elongates RNA at a rate of 70 nucleotides per second, and each transcription complex covers 70 bp of DNA.
(a) What is the maximum number of RNA molecules that can be produced per minute from a gene of $6000 \mathrm{bp}$ ? (Assume that initiation is not rate-limiting.)
(b) What is the maximum number of transcription complexes that can be bound to this gene at one time?

Joanna Quigley

Numerade Educator

06:20

Problem 2

The E. coli genome is approximately $4600 \mathrm{~kb}$ in size and contains about 4000 genes. The mammalian genome is approximately $3 \times 10^{6} \mathrm{~kb}$ in size and contains at most 50000 genes. An average gene in $E$. coli is 1000 bp long.
(a) Calculate the percentage of $E$. coli DNA that is not transcribed.
(b) Although many mammalian genes are larger than bacterial genes, most mammalian gene products are the same size as bacterial gene products. Calculate the
percentage of DNA in exons in the mammalian
genome

Niamat Khuda

Numerade Educator

04:16

Problem 3

There are a variety of methods that will allow you to introduce an intact eukaryotic gene (e.g., the triose phosphate isomerase gene) into a prokaryotic cell (see Chapter 23 ). Would you expect this gene to be properly transcribed by prokaryotic RNA polymerase? What about the converse situation, where an intact prokaryotic gene is introduced into a eukaryotic cell; will it be properly transcribed by the eukaryotic transcription complex?

Hannah Vigran

Numerade Educator

01:17

Problem 4

Assume that, in a rare instance, a typical eukaryotic triose phosphate isomerase gene contains the correct sequences to permit accurate transcription in a prokaryotic cell. Would the resulting RNA be properly translated to yield the intact enzyme?

Yifan Zhou

Numerade Educator

05:33

Problem 5

Describe how the rate of transcription of the lac operon is affected when $E$. coli cells are grown in the presence of (a) lactose plus glucose, (b) glucose alone, and (c) lactose alone.

Nalvi Duro

Numerade Educator

02:32

Problem 6

In the promoter of the $E$. coli lac operon the $-10$ region has the sequence: $5^{\prime}$-TATGTT-3'. A mutation named UV5 changes this sequence to: $5^{\prime}$-TATAAT-3' (see Figure 21.6). Transcription from the lac UV5 promoter is no longer dependent on the CRP-cAMP complex. Why?

Jenny Wu

Numerade Educator

02:03

Problem 7

When $\beta-\left[{ }^{32} \mathrm{P}\right]$-ATP is incubated with a eukaryotic cell extract that is capable of transcription and RNA processing, where does the label appear in mRNA?

Shazia Naz

Numerade Educator

02:25

Problem 8

Unlike DNA polymerase, RNA polymerase does not have proofreading activity. Explain why the lack of proofreading activity is not detrimental to the cell.

Parvati Devi

Numerade Educator

01:01

Problem 9

Mature mRNA from eukaryotic cells is often purified from other components in the cell with the use of columns containing oligo (dT) cellulose. These columns contain short segments of single-stranded deoxyribose thymidylate residues, oligo(dT), attached to a cellulose matrix. Explain the rationale for use of these columns to purify mature mRNA from a mixture of components.

Joanna Quigley

Numerade Educator

04:47

Problem 10

Rifampicin is a semi-synthetic compound made from rifamycin $\mathrm{B}$, an antibiotic isolated from Streptomyces mediterranei. Rifampicin is an approved antimycobacterial drug that is a standard component of combination regimens for treating tuberculosis and staphylococci infections that resist penicillin. Recent studies have suggested than rifampicin-resistant tuberculosis is becoming more common. For example, $2 \%$ of samples from a survey in Botswana were found to be resistant to the drug. The table below gives some results from wild type $E$. coli and $E$. coli with a single amino acid change in the $\beta$ subunit of RNA polymerase (Asp to Tyr at amino
acid position 516) and their growth response to media that
contained rifampicin. (Severinov, K., Soushko, M., Goldfarb, A., and Nikiforov, V. (1993). Rifampicin region revisited. J. Biol. Chem. 268:14820-14825). (a) What is your interpretation of the data?
(b) What role does the subunit have in RNA
polymerase?
(c) Describe one mechanism for rifampicin-resistant
bacteria.

Sana Riaz

Numerade Educator

02:52

Problem 11

A segment of DNA from the middle of an $E$. coli gene has the sequence below. Write the mRNA sequences that can be produced by transcribing this segment in either direction.
CCGGCTAAGATCTGACTAGC

Bryan Valdivia

Numerade Educator

01:37

Problem 12

Does the definition of a gene given on page 647 apply to the rRNA and tRNA genes whose primary transcript is shown in Figure 21.26?

Peggy Radtke

Numerade Educator

01:37

Problem 13

In general, if we know the genomic DNA sequence of a gene we can reliably predict the nucleotide sequence of the RNA encoded by that gene. Is this statement also true for tRNAs in prokaryotes? What about tRNAs in eukaryotes?

Pronoy Sinha

Numerade Educator

03:56

Problem 14

Assume that a spliceosome assembles at the first intron of the gene for triose phosphate isomerase in maize (Figure 21.29) almost as soon as the intron is transcribed (i.e., after about 500 nucleotides of RNA have been synthesized). How long must the spliceosome be stable if the splicing reaction cannot occur until transcription terminates? Assume that the rate of transcription by RNA polymerase II in maize is 30 nucleotides per second.

Kendrick Buford

Numerade Educator

View

Problem 15

CRP-cAMP represses transcription of the $c r p$ gene. Predict the location of the CRP-cAMP binding site relative to the promoter of the crp gene.

Farhan Anwar

Numerade Educator

01:01

Problem 16

Why are mutations within an intron of a protein-coding gene sometimes detrimental?

Joanna Quigley

Numerade Educator

05:22

Problem 17

A deletion in one of the introns in the gene for the triose phosphate isomerase moves the branch site to a new location 7 nucleotides away from the $3^{\prime}$-splice acceptor sequence. Will this deletion have any affect on splicing of the gene?

Sana Riaz

Numerade Educator