A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is

step 1 All right, this question gives you an MRNA strand and asks you to translate it. The trick to the

A scientist sequencing mRNA identifies the following strand:...

Key Concepts

Start and Stop Codons

The start codon, typically AUG, signals the beginning of translation and also codes for the amino acid methionine. Stop codons, such as UAA, UAG, and UGA, do not code for any amino acids and instead signal the termination of the polypeptide chain during translation.

Translation

Translation is the process by which ribosomes interpret the sequence of codons in mRNA to synthesize a polypeptide chain. During translation, transfer RNA (tRNA) molecules bring specific amino acids that correspond to each codon, ultimately resulting in the formation of a functional protein.

Reading Frame

The reading frame is the way in which nucleotides in mRNA are divided into consecutive, non-overlapping triplets or codons. Maintaining the correct reading frame from the start codon is crucial because even a single nucleotide shift can lead to a completely different sequence of amino acids and potentially a nonfunctional protein.

mRNA

Messenger RNA (mRNA) is a type of RNA that carries genetic information from DNA to the ribosome, where it serves as a template for protein synthesis. It is synthesized during transcription and contains codons that determine the order of amino acids in a protein.

Codon

A codon is a sequence of three nucleotides in mRNA that corresponds to a specific amino acid or a stop signal during protein synthesis. Codons are read in a sequential, non-overlapping manner during translation, and each codon specifies the incorporation of the correct amino acid into the growing polypeptide chain.

Transcript

Please give Ace some feedback