Question
In prokaryotes, the error rate in protein synthesis may be as high as $5 \times 10^{-4}$ per codon. What fraction of polypeptides containing(a) 500 residues or(b) 2000 residues would you expect to contain at least one amino acid substitution?
Step 1
This means that for every codon, there is a $5 \times 10^{-4}$ chance of an error occurring. Show more…
Show all steps
Your feedback will help us improve your experience
Shazia Naz and 78 other Organic Chemistry educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
a) Shown below is an mRNA. Using your knowledge of translation in prokaryotes, how many amino acids would you predict to be in the protein product encoded by this mRNA? 5’-ACUAGGAUGGCUUACCAGGAGGUCUCAUGACCGCUACCUUCACCUAAGCCACUA… b) Shown below is an mRNA. Using your knowledge of translation in eukaryotes, how many amino acids would you predict to be in the protein product encoded by this mRNA? 5’-Cap-ACUAGGAUGGCUUACCAGGAGGUCUCAUGACCGCUACCUUCACCUAAGCCACUA…
Calculate the probability of synthesizing an error-free protein of 50 amino acids and one of 300 amino acids when the frequency of inserting an incorrect amino acid is 10⁻². Repeat the calculations with error frequencies of 10⁻⁴ and 10⁻⁶.
Shown below is a prokaryotic mRNA. Using your knowledge of translation in prokaryotes, how many amino acids would you predict to be in the protein product encoded by this mRNA? 5' - ACAUGCUUACCAGGAGACUCAUGACCCCAGCUCCUUUCACCUAAGCCACUA...
Transcript
Watch the video solution with this free unlock.
EMAIL
PASSWORD