Referring to the genetic code presented in Figure 15.10 give...

Referring to the genetic code presented in Figure 15.10 give the amino acids specified by the following bacterial mRNA sequences. a. $5^{\prime}-$ AUGUUUAAAUUUAAAUUUUGA-3' b. $5^{\prime}-$ AGGGAAAUCAGAUGUAUAUAUAUAUAUGA-3' c. $5^{\prime}-$ UUUGGAUUGAGUGAAACGAUG GAUGAAAGAUUUCUCGCUUGA-3' d. $5^{\prime}-$ GUACUAAGGAGGUUGUAUGGG UUAGGGGACAUCAUUUUGA-3'

Referring to the genetic code presented in Figure 15.10 give the amino acids specified by the following bacterial mRNA sequences.
a. $5^{\prime}-$ AUGUUUAAAUUUAAAUUUUGA-3'
b. $5^{\prime}-$ AGGGAAAUCAGAUGUAUAUAUAUAUAUGA-3'
c. $5^{\prime}-$ UUUGGAUUGAGUGAAACGAUG GAUGAAAGAUUUCUCGCUUGA-3'
d. $5^{\prime}-$ GUACUAAGGAGGUUGUAUGGG UUAGGGGACAUCAUUUUGA-3'

Key Concepts

Genetic Code

The genetic code is a set of rules by which information encoded within genetic material (DNA or RNA sequences) is translated into proteins. It involves the mapping of mRNA codons, which are sequences of three nucleotides, to specific amino acids or a stop signal during protein synthesis. This code is nearly universal across all organisms, with slight variations in some cases.

mRNA Translation

mRNA translation is the biological process where the sequence of nucleotides in messenger RNA is converted into a sequence of amino acids, forming a polypeptide chain (protein). This process occurs in the ribosome and uses transfer RNA (tRNA) molecules to match codons with their corresponding amino acids.

Start Codon

The start codon is a specific codon in an mRNA strand, typically AUG in bacteria and eukaryotes, which signals the beginning of translation. It not only marks the starting point but also codes for the amino acid methionine, initiating protein synthesis.

Stop Codon

Stop codons are nucleotide triplets within mRNA that signal the termination of translation. In the genetic code, codons such as UAA, UAG, and UGA do not code for any amino acid and serve as molecular stop signals, prompting the ribosome to release the newly synthesized polypeptide.

Reading Frame

The reading frame is the way nucleotides in mRNA are divided into consecutive non-overlapping codons during translation. Selecting the correct reading frame is crucial because shifting the frame can change the entire sequence of the resulting amino acids, potentially leading to nonfunctional proteins.

Transcript

00:01 Dear student, the question is referring to the genetic code present in figure 15 .10, give the amino acid specified by the following bacteria and rna sequences.

00:13 Here are four questions.

00:16 I use for different highlighter to show some of the core, that aug code for methanine or amino f -methanine, ug, a codes for stop -coron or carbon, parboxyl and we have u uu that code for phenylalanine and a a a that core for lysine so we will write the first code here that first is amino then f methane then we said u you you mean nylon then we have a aided ly s for finding the code we will use this table then we have again you the same phe then we have mys we have phe and then we have the h e and then the stop cordon that is carb oxen so for the second reviews amino acid oh sorry amino f mat then a ua is here a u a it is t y r then we have a u a u a here and a here that is i lea it iso place it iso place then we have u a u again it is thyracine then we have the same cordon a u a which is is i so we have this one and then carboxylic or stop cora in the third we have the same amino f mat after amino of met we have g .a .u.

03:21 What g .a .u.

03:22 Is? that is asp.

03:31 So we will write it.

03:33 G .a .u is mentioned here.

03:35 So we will write asp.

03:39 Then we will write gaa.

03:45 That is here the core glu used for galu.

03:53 And we have aga.

04:06 Aga is here...