Numerade

Questions asked

BEST MATCH

Three particles are fixed on an x axis. Particle 1 of charge $q_1$ is at $x = -a$ and particle 2 of charge $q_2$ is at $x = +a$. If their net electrostatic force on particle 3 of charge Q is to be zero, what must be the ratio $q_1/q_2$ when particle 3 is at (a) $x = +0.434a$ and (b) $x = +2.38a$? (a) Number 6.42 Units No units (b) Number Units No units

View Answer

BEST MATCH

Jeeves and Elizabeth would like to form a business that gives them protection from liability but is taxed like a partnership. They have investigated S-corporations but rejected them as having too many government regulations. They should form a corporation. joint venture. limited liability company. general partnership.

View Answer

BEST MATCH

In 2015, Canada aligned their WHMIS legislation with an international set of guidelines (for classifying hazardous materials) which is known by what acronym? (Hint: just 3 letters)-

View Answer

BEST MATCH

The sleep-wake cycle is ultimately controlled by the part of the brain called the _____ A frontal lobe B optical nerve C median forebrain bundle D hypothalamus

View Answer

BEST MATCH

with source and references,, How have HIPAA legislation and the Affordable Care Act affected reimbursement in the United States, and how will they continue to affect reimbursement in the coming years?

View Answer

BEST MATCH

Question 2: Answer each of the following Points: /4 CLO 1.2 1) The memory locations 1000, 1001 and 1004 have data values 18, 2 and 16 respectively before the following program execute. MOVI Rs, 1 Move immediate LOAD Rd, 1000 (Rs) Load from memory (displacement addressing mode) ADDI Rd, 1000 Add immediate after the program get executed. a. What is the content of register Rs? A4 b. What is the content of register Rd after execting the second instruction? B18 c. What is the content of register Rd after execting the third instruction? C1018

View Answer

BEST MATCH

You have been tasked by a new pharmaceutical company to explain the procedures you will follow to produce stick protein. Stick protein is found in a newly discovered pathogenic plant, that cause illness in Humans after touching it. The pharmaceutical company needs to immunize humans against stick prsten to prevent thess The board at the pharmaceutical company wants you to explain how to produce pure stick protein in a bacterial system if all you are given is some of the pathogenic plant cells and you know the sequence of the stick gene and pQE30 plasmid expression vector.Kpal recognitionStick protein (DNASall recognition siteATGACommPQE-30 3.5 kb3.1. Explain how you will you make the cDNA of the stick protein?3.2. How will you express/produce the stick protein in a bacterial system/ E. coli cells?3.3. How will you purify the protein?3.4. Which technique would you use to confirm the purity of the stick protein?3.5. Assuming the spike protein got incorporated into the human genome. Explain a molecular biology strategy Chat you could use to edit or remove it..

View Answer

BEST MATCH

(b) Let $S = S_1 \times S_2 \subset \mathbb{R}^{n_1} \times \mathbb{R}^{n_2}$, where $S_1$ and $S_2$ are nonempty closed convex set in $\mathbb{R}^{n_1}$ and $\mathbb{R}^{n_2}$ respectively. Suppose that $\vec{x} = (\vec{x}_1, \vec{x}_2) \in S$. Show that \begin{equation*} N_S(\vec{x}) = N_{S_1}(\vec{x}_1) \times N_{S_2}(\vec{x}_2). \end{equation*}

View Answer

BEST MATCH

CGUAUACUAGACUGCUGGUCUAGUUACU

View Answer

BEST MATCH

cubic feet of water.

View Answer

alvaro s.