Numerade

Questions asked

BEST MATCH

Find the matrix $A$ of the orthogonal projection $proj_L: \mathbb{R}^2 \rightarrow \mathbb{R}^2$ onto the line $L$ in $\mathbb{R}^2$ spanned by the vector $\begin{bmatrix} 1 \\ 3 \end{bmatrix}$ with respect to the standard basis of $\mathbb{R}^2$. $A = \begin{bmatrix} & \\ & \end{bmatrix}$

View Answer

BEST MATCH

Now explain why the importance of branch prediction changes that way with pipeline depth:

View Answer

BEST MATCH

11. Find the value of the indicated variables. (Hint: "F" pattern, "Z" pattern, sum of angles in a triangle, etc.) a) x = x y 92° y = c) b 71° a b) a = d) b = x = y = x 63° 52° 132° m o n 93° m = n = y

View Answer

BEST MATCH

ing, Incorporated, has debt outstanding with a face value of $4.7 million. The value of the firm if it were entirely financed by equity would be $19.1 million. The company also has 350,000 shares of stock outstanding that sell at a price of $43 per share. The corporate tax rate is 22 percent. What is the decrease in the value of the company due to expected bankruptcy costs? (Do not round intermediate calculations and enter your answer in dollars, not millions of dollars, rounded to the nearest whole number, e.g., 1,234,567.)

View Answer

BEST MATCH

16. Bocky Rolboa finishes his morning jog strong by sprinting up the steps to the entrance of a national monument at 20 ft/sec. If the steps are angled 30 degrees above the horizontal, what is the rate at which his elevation is increasing? 16 ft/sec 10 ft/sec 8 ft/sec 14 ft/sec 12 ft/sec

View Answer

BEST MATCH

Find U(P, f) & L(P, f) where P is a partition of I and f: I --> R is a function f(x) = 2x + 4, for all x belongs to [2,3]; P = {2, 2.2, 2.4, 2.6, 2.8, 3}

View Answer

BEST MATCH

Part II: Information Transfer The omitted bases in the following instructions will be provided during your tutorial session. Below is a sequence of eukaryotic DNA containing a hypothetical gene for protein X. The base that is first (at the 5' end) in the sequence is at position -15. Remember that DNA sequences do NOT have a position 0. The translational start site is the first initiating codon (start codon) encountered after the transcriptional start (+1). This gene has three exons. The last base of the first exon is the G at position +31; the first base of the second exon is the T at position +60; the last base of the second exon is the T at position +83; the first base of the third exon is the A at position +108; the last base of the third exon is for you to determine. DNA sequence containing gene for protein X: 5'- TATATACTGT ATGGTGGGTT GATCTATGTA TCAACAGTAC GGCTCGCAGG TACCCGATGA GATGGGAAGG TGGGTTGACA GCTAGCAGTA GCGACAGTTT CGATTCCGTC GAGTTCCAAGCTTTAGCTAGTTTTAGCGGGAGGTACCCGATT AGCTATGGCT GATCGATCGC TAGCATCGATTGGACTAGGATTGTGGCTTA -3' 5. Beginning with the start codon, what are the first 20 nucleotides of your mRNA sequence (4 marks)? 6. What is the full polypeptide sequence of the newly translated protein X (specify the amino and carboxyl termini) (4 marks)? 7. A mutation occurs in the original DNA sequence for protein X such that the thymine nucleotide at position +61 is deleted. What is the effect of this mutation (2 marks)? 8. A mutation occurs in the original DNA sequence for protein X strand such that the thymine nucleotide in position +48 is changed to a cytosine. What is the effect of this mutation (2 marks)?

View Answer

BEST MATCH

A teacher is helping a withdrawn child to increase his interaction with other students. The teacher has the other children in the classroom smile and compliment the child when he talks to them. The teacher also instructs the other children not to laugh when the withdrawn child has problems speaking. Which strategy for promoting generalization is the teacher using?

View Answer

BEST MATCH

Evaluate the integral by converting to polar coordinates.\\ $\int_0^2 \int_y^{\sqrt{8-y^2}} \frac{1}{\sqrt{1+x^2+y^2}} dx dy = $

View Answer

BEST MATCH

QUESTION 13 Which is the correct order for Tuckman's five group development stages? a. Norming, forming, storming, performing, adjourning b. Norming, storming, performing, forming, adjourning c. Forming, storming, norming, performing, adjourning d. Forming, norming, performing, storming, adjourning QUESTION 14 In which of Tuckman's group development stages might members compete for status and openly disagree? a. Forming b. Storming c. Norming d. Performing QUESTION 15 In which phase of group development do members agree on how to achieve a goal and who will do what? a. Adjourning b. Norming c. Performing d. Forming QUESTION 16 When members of a group engage in groupthink, they do NOT a. exhibit too much cohesion. b. critically evaluate options. c. focus on harmony. d. discourage outside input. QUESTION 17 At what stage in the situational view of leadership does shared decision making occur while simultaneously less direction is provided? a. Participating b. Selling c. Telling d. Adjourning QUESTION 18 According to Hersey and Blanchard, member readiness refers to the extent that members have experience, knowledge, and motivation to work together. a. True b. False

View Answer

amy a.