Numerade

Questions asked

BEST MATCH

Determine the balance owing after making the 42nd month-end payment of $470 on a loan of $39,808 if the rate of interest is 4% compounded semi-annually.

View Answer

BEST MATCH

The following DNA sequence includes the translation start site for a protein-coding gene (by convention, the top strand is 5'?3'): ATGCATGTATGGACAGTGCATGCATCCAT TACGTACATACCTGTCACGTACGTAGGTA A) Before we know which strand is the coding strand, how many reading frames are possible? 6 reading frames possible 3 top strand 3 lower strand without knowing which strand is template strand. B) If we are told the upper-strand is the template-strand, how many reading frames are possible? 3 reading frames if upper strand is template C) Assuming the codon shown in green is the start, write the mRNA sequence (label the 5'- and 3'-ends) D) Write the sequence of the encoded protein (label the amino and carboxyl ends) 5' N-term (amino end) 3' C-term (carboxyl end)

View Answer

BEST MATCH

Suppose that Apple acquired a manufacturer of microcrystal screen protectors. This merger would be classified as a:

View Answer

BEST MATCH

a M Consider a large circular shaft of radius R = 0.5 m that is part of a drilling rig. During its life cycle, the shaft will be subjected to an alternating bending stress due to the shaft rotation and the applied moment M = 10kN m. A small crack emerges at the edge of the shaft as shown in the figure above. Laboratory fatigue tests were done and determined the form of the Paris Law for the material that the shaft is made out of to be: $\frac{da}{dN} = A(\Delta K)^3$ with the Paris Law constant A determined to be: A = $10^{-20}$ m (Nm$^{-3/2}$)$^{-3}$ (a) How many cycles would it take for the crack to grow from 1 mm to 10 mm? (b) Identify 5 suitable materials to use here, by plotting an Ashby Map of Fatigue Strength and Density.

View Answer

BEST MATCH

27. a. Dr. Pension Expense; Cr. Cash for $31,500 b. Dr. Projected Benefit Obligation; Cr. Cash for $31,500 c. Dr. Plan Assets; Cr. Projected Benefit Obligation for $31,500 d. Dr. Projected Benefit Obligation; Cr. Plan Assets for $31,500 28. a. Dr. Plan Assets; Cr. OCI-Gain/Loss for $5000 b. Dr. OCI-Gain/Loss; Cr. Projected Benefit Obligation for $87,000 c. Dr. Pension Expense; Cr. Projected Benefit Obligation for $87,000 d. Dr. Plan Assets; Cr. Projected Benefit Obligation for $87,000 29. a. 190,000 b. 244,000. c. (244,000) d. (190,000) Note: "()" means credit balance. 30. a. 680,000 b. 755,500 c. (680,000) d. (755,500)

View Answer

BEST MATCH

4. (12 points) Find the mesh currents $i_1$, $i_2$, and $i_3$ for the circuit shown below. 2? $i_1$ 3? 9? 15 V $i_2$ 6? $i_3$ 21 V

View Answer

BEST MATCH

3. Consider the circuit shown below. The switch in the circuit is closed at $t = 0$ and at that moment, the capacitor is in DC steady state. Fill in the table below. 3 mA 1 k\Omega 4 V 4 k\Omega 1 \mu F 2 k\Omega t=0 a $v_c(t = 0^-)$ b $v_c(t = 0^+)$ c $v_c(t = \infty)$ d $i_c(t = 0^+)$ e $v_c(t)$ expression for $t > 0$

View Answer

BEST MATCH

39. A process schematic for a heat-exchanger is shown below. You are tasked with designing the controller. During an open loop experimental test, the steam pressure $P_s$ was increased from 18 to 20. psig and the temperature $T_{2m}$ is shown below. The control valve and IP transducers have negligible dynamics and gains of $K_v = 0.9$ and $K_{ip} = 0.75 \frac{mA}{psig}$. (a) Draw a block diagram for the process (b) Determine PID controller parameters using (i) Direct Synthesis (ii) ITAE setpoint (iii) Cohen-Coon (iv) Zeigler-Nichols $T_{2m}$ $T_2$ $T_1$ time (min) $T_{2m}$ (mA) 0 12.0 1 12.0 2 12.5 3 13.1 4 14.0 5 14.8 6 15.4 7 16.1 8 16.4 9 16.8 10 16.9 11 17.0 12 16.9

View Answer

BEST MATCH

Given the circuit in the figure, find the average power supplied or absorbed by each element. Take $R = 10 \Omega$. $-j4 \Omega$ $j1 \Omega$ $2 \angle 0^{\circ} A$ $R$ The average power supplied by the current source is W. The average power absorbed by the 10-$\Omega$ resistor is W. The average power absorbed by the inductor is W. The average power absorbed by the capacitor is W.

View Answer

BEST MATCH

A special order request for 20,000 widgets just showed up on your desk. The customer has asked for special engraving, at an additional cost of $1 per widget. They are also asking for a 20% discount on your regular price of $10 (so they want to pay $8 per widget). If you have some idle production space, and this job would net $5,000 after all expenses, do you take the special order? No, since they are asking for a discount and require additional engraving cost, a) we will use the idle time to build up inventory of our regular priced widget and turn down the special order. b) No, since they are asking for a discount, plus there is an additional engraving cost, we will not take the special order. c) Yes, since the customer is a close friend of CEO, we should take the special order for a job security. d) Yes, since it will show a net profit and we have the idle capacity, we will ta the special order.

View Answer

emily b.