Numerade

Questions asked

BEST MATCH

Impressionist painter, Renoir, had these subjects and characteristics in his paintings except this: (select the false statement) Group of answer choices Voluptuous, peach-skinned female nudes Quick brushstrokes with rich reds and detested black- used blue instead dark patches against light, used black as accent subjects were cafe society, children and flower

View Answer

BEST MATCH

Transcribe the following DNA sequence from HBA record your answer to submit for grading DNA sequence five – AGTAACGGCAGACTTCTCCTCAGGAGTCAGGTGCACCAT – 3MRNA sequence hint by convention a nucleic acid sequence is always written 5 to 3 unless otherwise noted what is the mRNA sequence

View Answer

BEST MATCH

(14) Identify whether the following characteristics of allosteric regulation of glycogen phosphorylase apply to the muscle or liver. (a) AMP binding induces R state (b) a form is the default state (c) activation liberates glucose for export (d) activation generates glucose for the cell (e) glucose binding induces the T state (f) b form is the default state

View Answer

BEST MATCH

What mode or modes of inheritance are possible for the ringed hair trait in this family? Be sure to try different genotypes to see which types of inheritance work (i.e. not just what is the best explanation!) X-linked recessive only • Autosomal dominant only • Either autosomal dominant or autosomal recessive

View Answer

BEST MATCH

A 4154-kg truck traveling with a velocity of 12(m)/(s) due east collides head-on with a 904-kg car traveling with a velocity of 40(m)/(s) due west. The two vehicles stick together after the collision. What is their shared velocity in (m)/(s) after the collision? Define East to be the positive direction. Type your answer without the units. ◻ QUESTION 14 The change in momentum for the driver of a car hitting a brick wall at 10(m)/(s) is the same with and without air bags. Suppose a driver comes to a complete stop in 0.1s without an air bag. Suppose also that the same driver comes to a complete stop in 0.5s with an airbag. What is the ratio of the average force during the deceleration with and without an airbag? QUES11ON13 A 4154-kg truck traveling with a velocity of 12 m/s due east collides head-on with a 904-kg car traveling with a velocity of 40 m/s due west. The two vehicles stick together after the collision. What is their shared velocity in m/s after the collision? Define East to be the positive direction. Type your answer without the units QUESTION14k The change in momentum for the driver of a car hitting a brick wall at 10 m/s is the same with and without air bags. Suppose a driver comes to a complete stop in 0.1 s without an air bag.Suppose also that the same driver comes to a complete stop in 0.5 s with an airbag. What is the ratio of the average force during the deceleration with and without an airbag?

View Answer

BEST MATCH

Ryker views all of his friendships from a "take" perspective, meaning that they exist mostly to fulfill his own needs. Which stage of childhood friendships is Ryker experiencing? Group of answer choices momentary playmates stage fair-weather friend stage one-way assistance stage mutual intimacy stage

View Answer

BEST MATCH

What did the "First Name Club" agree on when they met? A) An elastic currency supply that was held by one bank, which held reserves of all banks B) The national branch would set discount rates but only in specific regions C) To be democratic in its method and scientific in its control D) That bankers should be supported no matter what

View Answer

BEST MATCH

17. What were the different objectives of the Human Genome Project? 18. Why are researchers unable to give and single number to the length of the human genome? 19. Why does it appear that the X chromosome has an excessive number of disease causing genes? 20. What is a gene desert?

View Answer

BEST MATCH

What is minor loss in pipe flow? How is the minor loss coefficient $K_L$ defined? 8-63 Water is to be withdrawn from an 8-m-high water res- ervoir by drilling a 2.2-cm-diameter hole at the bottom sur- face. Disregarding the effect of the kinetic energy correction factor, determine the flow rate of water through the hole if (a) the entrance of the hole is well-rounded and (b) the entrance is sharp-edged. 8-64 Consider flow from a water reservoir through a circu- lar hole of diameter $D$ at the side wall at a vertical distance $H$ from the free surface. The flow rate through an actual hole with a sharp-edged entrance ($K_L = 0.5$) is considerably less than the flow rate calculated assuming \"frictionless\" flow and thus zero loss for the hole. Disregarding the effect of

View Answer

BEST MATCH

(1 point) Find all values of $x$ where the given series converges. $\sum_{n=1}^\infty \frac{9^n x^n (n+1)}{n+11}$ Answer: Note: Give your answer in interval notation.

View Answer

felicia r.