Ace - AI Tutor
Ask Our Educators
Textbooks
My Library
Flashcards
Scribe - AI Notes
Notes & Exams
Download App
jennifer griffith

jennifer g.

Divider

Questions asked

BEST MATCH

____ is a plasma protein that circulates in the blood until a thrombomodulin-thrombin complex activates it. This activated chemical then inactivates various clotting factors, thereby preventing coagulation.

View Answer
divider
BEST MATCH

15. DETAILS MY NOTES Solve each equation for x. (Find exact answers, not decimal approximations.) (a) $9^x - 8 = 8$ x = (b) $\ln(x) + \ln(x - 1) = 1$ x =

View Answer
divider
BEST MATCH

Consider the permutation pi = (1, 8, 9, 4, 3, 2, 5, 6, 7, 11, 10, 12). Using the 2-approximation algorithm, what is the number of unsigned reversals required to transform it to an identity permutation? Is this optimal?

View Answer
divider
BEST MATCH

Given a price increase for an inferior good, the income effect will cause its consumption to ________, and the substitution effect will cause its consumption to ________.

View Answer
divider
BEST MATCH

Consider the following parametric equations, $x = -1 - 2t$, $y = 3t - 3$; $-5 \le t \le 5$. Complete parts (a) through (d) below. a. Make a brief table of values of $t$, $x$, and $y$ \begin{tabular}{|c|c|c|c|c|c|} \hline t & -5 & -3 & 0 & 3 & 5 \\ \hline x(t) & 3 & 1 & -2 & -5 & -7 \\ \hline y(t) & 12 & 6 & -3 & -12 & -18 \\ \hline \end{tabular} (Type integers or decimals.) b. Plot the $(x, y)$ pairs in the table and the complete parametric curve, indicating the positive orientation (the direction of increasing c. Eliminate the parameter to obtain an equation in $x$ and $y$ d. Describe the curve. A. A line segment falls from right to left as $t$ increases. B. A line segment falls from left to right as $t$ increases. C. A line segment rises from left to right as $t$ increases. D. A line segment rises from right to left as $t$ increases.

View Answer
divider
BEST MATCH

Question 1 An input signal $x(t)$ is fed into a linear time invariant system with an impulse response $h(t)$. $x(t) = 3[u(t) - u(t - 2)]$ $h(t) = \begin{cases} 2t & 0 \le t \le 4 \\ 0 & \text{otherwise} \end{cases}$ where $u(t)$ is the unit step function. (a) Sketch $x(t)$, $h(t)$ and $h(2 - t)$. (b) Find the convolution of $y(t) = h(t) * x(t)$ for all $t \ge 0$.

View Answer
divider
BEST MATCH

The sum of \frac{4}{c-2} and \frac{5}{c+8} is equal to \frac{112}{c^2+6c-16}. Solve for c.

View Answer
divider
BEST MATCH

6. A segment of a polypeptide chain is Ser -Pro-Arg-Lys-Gln-Leu-Ala, encoded by the following DNA (the sequence aligns so the first amino acid starts with the first nucleotide of one of the strands/ directions): GCGATCGACGAAGGAACCCCT |||||||||||||||||| CGCTAGCTGCTTCCTTGGGGA a) Which strand is the coding strand (top or bottom)? b) Which strand is a template stand (top or bottom)? c) Label each strand with polarity (5' or 3') d) What is the mRNA sequence? (Write below and label the 5' and 3' ends of your mRNA): 7. For the polypeptide sequence (a very tiny protein, only 3 amino acids): Met-Trp-Phe. Write out are all of the possible mRNA strands that can encode this protein sequence. (Hint, there are six)

View Answer
divider
BEST MATCH

A full-wave SCR rectifier is supplied by a 120 Vrms 60 Hz AC voltage source. The rectifier is ideal with zero forward voltage drop in each SCR and feeds an R-L load where the resistive load is R = 10. The firing angle of the SCR bridge is θ. The delay angle in the output voltage across the load due to the inductive load nature is δ. Both θ and δ are referenced at the zero crossing. During the period between θ and δ, the output voltage is expected to be zero. Assume that the source is a sine wave. a. If θ > 0, find the RMS output voltage as a function of time, t, and θ. b. If δ = 43.2 and the time equivalent of δ is the time constant L/R, find the value of the load inductance L if the RMS output voltage is approximately 112 V. c. If δ = 86.4 and L is changed to be 15 mH, what is the new RMS output voltage?

View Answer
divider
BEST MATCH

QUESTION 3 [14 Marks] Ms Reginalda would like to have an automated lighting system for her bedroom. She is a Geologist at Ministry of Mines and Energy, hence she does not even know what a NAND gate is, however she is very enthusiastic about new technologies and automation. She approached you to design a digital system for automating her bedroom lights. The digital system should have three sensor inputs as shown in Fig 3 Sensor A: to detect if it is sunny or dark outside her house. Sensor B: to detect if the room curtain is closed or open and Sensor C: to detect her presence in the room. Inputs Output Sensor A Sensor B Digital System Lights (L) Sensor C Fig 3: System Block Diagram The system activate the Lights UNLESS the following conditions arise She is not in the room (Sensor C =0). She is in the room (Sensor C=1), but the curtain is open (Sensor B=1) and it is sunny outside (Sensor A =1). (a) Derive the truth table for this system. [4] (b) Obtain the SOP expression for the system from the truth table. [2] (c) Reginalda has a limited budget. Using Karnaugh Map techniques, minimise the SOP expression in (b). [4] (d) Derive the equivalent POS expression from the Karnaugh Map. [2] (e) Using the expression from (c), draw the logic circuit using only NAND gates. [2]

View Answer
divider