Numerade

Questions asked

BEST MATCH

3. To create two restriction enzyme that will remove the gene of interest shaded in grey from the rest of the DNA, you must find two ideal recognition sites, one to the left and one to the right of the gene. Look at the sequence below and choose appropriate recognition sites on both sides of the desired sequence and indicate where your enzyme will cut in each site. Show the recognition site sequences by underlining or highlighting them. Remember that the sequence you choose must be a palindrome, and you also need to have it be 5 bases long. You may do either a sticky or a blunt end for your cut. 5' AACTGATATCGACCCAGATCAGCGCTAA 3' TTGACTATAGCTGGGTCTAGTCGCGATT 3' 5'

View Answer

BEST MATCH

The thick fibrocartilage disks found in the knee joint are called_____ ? a. tendon sheaths ? b. ligaments ? c. bursae ? d. menisci ? e. intraknee disks

View Answer

BEST MATCH

A 675 kV transmission line carries a current of 836 amps and has a resistance of 15 ohms. What is the power lost in the line in Watts?

View Answer

BEST MATCH

1. a. Let X and Y be independent random variables having the exponential distribution with parameters $\lambda$ and $\mu$ respectively. Find the density function of X + Y. b. Suppose that we have two independent random samples: $X_1, \dots, X_n$ are exponential ($\lambda$), and $Y_1, \dots, Y_m$ are exponential ($\mu$). Find the likelihood ratio test of $H_0: \lambda = \mu$ versus $H_1: \lambda \neq \mu$.

View Answer

BEST MATCH

1 Overview You will be making a binary search tree class. Then you will use it to import a text file and create a word frequency histogram. 2 Specification Your binary search tree class should have the following methods: • search—finds and returns the node that matches a search key (if it exists; otherwise return null) • insert—inserts a node into the tree • delete—deletes a node from the tree • print—traverse (inorder) and print each node • any methods you need to solve the problem of using a tree to make a word frequency his- togram. You should be able to read a file and add a word if it isn't in the tree yet and update a counter associated with it if it is in the tree. Example Input: This sentence repeats words because a sentence that repeats words makes a good example sentence. Output: a 2 because 1 example 1 good 1 makes 1 repeats 2 sentence 3 that 1 this 1 words 2

View Answer

BEST MATCH

Appraise and classify the major themes of international economics and the main types of international economic organizations.

View Answer

BEST MATCH

Solve the following quadratic equation by using the quadratic formula. $2x^2 + x - 3 = 0$

View Answer

BEST MATCH

27. Solve $1\frac{1}{2}(x - 1) > 4$. A. $2x - 2 > 4$ B. $x - 1 > 6$

View Answer

BEST MATCH

7. What does the Central Limit theorem say about the standard deviation of the sampling distribution of the sample means? A. The standard deviation of the sampling distribution of the sample mean is equal to the population standard deviation divided by the square root of the sample size. B. The standard deviation of the sampling distribution of the sample mean is close to the population standard deviation if the sample size is large. C. The standard deviation of the sampling distribution of the sample mean is exactly equal to the population standard deviation. D. The standard deviation of the sampling distribution of the sample mean is less than the population standard deviation.

View Answer

BEST MATCH

QUESTION 1 Convert -32 °F to °C. Round to the nearest hundredth. I

View Answer

jonathon s.