Ace - AI Tutor
Ask Our Educators
Textbooks
My Library
Flashcards
Scribe - AI Notes
Notes & Exams
Download App
josefina parker

josefina p.

Divider

Questions asked

BEST MATCH

What are the critical changes that search marketers and site designers will have to make to optimize their websites for Web 3.0?

View Answer
 divider
BEST MATCH

5' Terminator Sequence ACCUG TGGATCGTGGACACACTGCA Promoter Sequence 3' When the RNA strand is elongated, what is the next nucleotide that will be added in the process of transcription and why? C, because the A in the RNA sequence is the 3' end, and RNA polymerase synthesizes RNA 5' to 3', antiparallel to the template strand that has a G nucleotide U, because the G in the RNA sequence is the 5' end, and RNA polymerase synthesizes RNA 3' to 5', antiparallel to the template strand that has an A nucleotide C, because the A in the RNA sequence is the 5' end, and RNA polymerase synthesizes RNA 3' to 5', antiparallel to the template strand that has a G nucleotide U, because the G in the RNA sequence is the 3' end, and RNA polymerase synthesizes RNA 5' to 3', antiparallel to the template strand that has an A nucleotide

View Answer
 divider
BEST MATCH

45. Which one of the following terms best describes the complete structure of a nitrogenous base with oxygens at positions 2 and 4 and ribose at position 1? A. Thymine B. Uracil C. Uridine D. Cytidine

View Answer
 divider
BEST MATCH

With reference to nutrient standards, DRI stands for Multiple choice question. Daily Required Intake. Daily Reference Intake. Dietary Reference Intake. Daily Recommended Intake.

View Answer
 divider
BEST MATCH

Question 1 With the help of appropriate equations and diagrams, discuss briefly the process of energy conversion occurs in a basic electromechanical system.

View Answer
 divider
BEST MATCH

A single acting reciprocating pump of 200 mm bore and 300 mm stroke runs at 30 rpm. The suction head is 4 m and the delivery head is 15 m. Considering acceleration determine the pressure in the cylinder at the beginning and end of suction and delivery strokes. Take the value of atmospheric pressure as 10.3 m of water head. The length of suction pipe is 8 m and that of delivery pipe is 20 m. The pipe diameters are 120 mm each.

View Answer
 divider
BEST MATCH

Repaui patnuslip allocation Schedule i. A salary allowance of $30,000 to Brewer and $15,000 to Roberts. ii. An interest allowance of 5% on beginning capital balances. Required: i. Compute the allocation of net income by completing the schedule below. ii. Prepare the December 31, 2016 journal entry to record the transfer of the net income to the partners' capital accounts. Total Roberts item Brewer Total journal entry

View Answer
 divider
BEST MATCH

S11-11 (similar to) Catskills Corrector guarantees its snowmobiles for three years. Company experience indicates that warranty costs will be approximately 4% of sales. Assume that the Catskills dealer in Colorado Springs made sales totaling $750,000 during 2016. The company received cash for 20% of the sales and notes receivable for the remainder. Warranty payments totaled $23,000 during 2016. Requirements 1. Record the sales, warranty expense, and warranty payments for the company. Ignore cost of goods sold. 2. Post to the Estimated Warranty Payable T-account. At the end of 2016, how much in Estimated Warranty Payable does the company owe? Assume the Estimated Warranty Payable is $0 on January 1, 2016. Requirement 1. Record the sales, warranty expense, and warranty payments for the company. Ignore cost of goods sold. (Record debits first, then credits. Select the explanation on the last line of the journal entry table.) Begin with the entry to record the sales. (Prepare a single compound entry for this transaction.) Date 2016 Accounts and Explanation Debit Credit Choose from any list or enter any number in the input fields and then click Check Answer. parts 3 remaining Clear All Check Answer

View Answer
 divider
BEST MATCH

4) You have an attacker who is sending you a large number of TCP ACK packets (ACK flood attack). Give an example of firewall rule that you might use to prevent this. The actual syntax of the rule is not important. 4pts

View Answer
 divider
BEST MATCH

6.11. Consider the autocatalytic reaction A \rightarrow R, with $-r_A = 0.001 C_A C_R$ mol/liter \cdot s. We wish to process 1.5 liters/s of a $C_{A0} = 10$ mol/liter feed to the highest conversion possible in the reactor system consisting of four 100-liter mixed flow reactors connected as you wish and any feed arrangement. Sketch your recommended design and feed arrangement and determine $C_{Af}$ from this system.

View Answer
 divider