Numerade

Questions asked

BEST MATCH

An example of a sympathetic effect on a primate's body would be A an increase in epinephrine released by chromaffin cells in the adrenal medulla. B an increase in sweating and erection of body hair (aka goosebumps). C a decrease intestinal motility, as well as a decrease in secretion of digestive enzymes. D greater cardiac output through an increase in heart rate and stroke volume. E all of the above

View Answer

BEST MATCH

What is the coefficient of water after balancing the following equation? __H3PO4(aq) + __Ba(OH)2(aq) → __Ba3(PO4)2(s) + __H2O(l) Question 12 options: 1 2 6 3 none of the above

View Answer

BEST MATCH

Tessa did not miss a free throw in her past five basketball games. Since their free-throw streak started, Tessa has not washed their socks because they have associated the socks with the streak. Tessa is demonstrating: successive approximations. superstitious behavior. shaping. secondary reinforcement.

View Answer

BEST MATCH

Which of the following areas is NOT part of the "Dodd-Frank Wall Street Reform and Consumer Protection Act of 2010": Consumer Financial Protection Bureau The "Volcker rule" End too big to fail bailouts Provide Federal Insurance to all financial institutions Transparency and accountability for exotic instruments

View Answer

BEST MATCH

7. In which direction does the molecular dipole point in the molecule C$_2$H$_6$? a. Towards one end or the other on the carbon-carbon bond axis, to the hydrogen atoms there. b. To one carbon atom or another, in the middle of the molecule. c. Between the two carbon atoms, either up or down from the main axis of the molecule. d. Towards a terminal hydrogen atom. e. There is no dipole in this molecule.

View Answer

BEST MATCH

Search the NCBI Nucleotide database for NG_021275, then download the record in FASTA format and save the file as NG_021275.fasta under the assignment project folder in PyCharm. Then write a Python script a8q4.py that calculates GC content where the sequence data is read in from the above FASTA file. After the sequence record is read in from the FASTA file, print the sequence ID, the nucleotide sequence, then print the GC content to the screen with two decimal places. A sample output could be (the entire sequence is omitted) Sequence ID: NG_021275.2 Sequence: TCCTTCACAGGAAAGGGTCACT ... The GC content of the sequence is: 43.33%

View Answer

BEST MATCH

3. In how many ways can a coin be flipped 4 times in a row with at least two consecutive flips resulting in heads?

View Answer

BEST MATCH

Which one of the following statements concerning dilution is correct? Select one: Oa. Dilution of percentage ownership occurs whenever an investor participates in a rights offer. Ob. Market value dilution increases as the net present value of a project increases. c. Market value dilution occurs when the net present value of a project is negative. Od. Neither book value dilution nor market value dilution has any direct bearing on individual shareholders. e. Book value dilution is the cause of market value dilution.

View Answer

BEST MATCH

c) Make a table of these antennas from narrowband to wideband: a) bow-tie antenna, b) helical antenna, c) folded dipole antenna, d) Yagi-Uda array antenna, e) small loop antenna with 1000 turns.

View Answer

BEST MATCH

Find the absolute minimum of $f(x) = x^3 + 6x^2 + 5$ on the interval $[-5, 5]$.

View Answer

miguel -ngel h.