Ace - AI Tutor
Ask Our Educators
Textbooks
My Library
Flashcards
Scribe - AI Notes
Notes & Exams
Download App
teresa holmes

teresa h.

Divider

Questions asked

BEST MATCH

2. You generated an alignment of a region of 800 bp that is part of a protein coding exon. The data are 10 sequences (different individuals) from Species A (SpA-1...SpA-10), and 1 sequence from (one individual) species B (SpB). For simplicity, only the 23 sites (of 800) that have one or more changes within species or between species are shown. Asterisks (*) below each column (each nucleotide) indicate the mutation changes an amino acid (nonsynonymous change); all the other mutations are synonymous. "." Indicates same nucleotide as the one observed in the first sequence. ACCCATATGCATTATCGAACGAT SpA-1 SpA-2 G SpA-3 G T AA SpA-4 G SpA-5 T G G SpA-6 T A SpA-7 T SpA-8 SpA-9 A SpA-10 T SDB T * * C GT A. T T T TC T C A A GAG Count the number of Replacement substitutions, Replacement mutations, Silent substitutions, and Silent mutations. Replacement substitutions: Replacement mutations: Silent substitutions: Silent mutations: Is this gene under purifying or positive selection? Why?

View Answer
divider
BEST MATCH

The tax burden for a good falls largely on ______. a. the producers who have a more elastic supply of the good b. the producers who have unit elastic supply of the good c. the consumers who have a less elastic demand for the good d. the consumers who have unit elastic demand for the good

View Answer
divider
BEST MATCH

Royal Furniture bought a sofa for $880. The sofa had a $1,480 list price. What was the trade discount rate Royal received?

View Answer
divider
BEST MATCH

Kokoto Contractors Ltd was formed on 1 January 2006 and the following purchases and sales of machinery were made during the first 3 years of operations: \begin{tabular}{|l|l|l|l|} \hline Date & Asset & Transaction & Price \\ \hline 1 January 2006 & Machine 1 and 2 & Purchase & Kshs. 400,000 each \\ \hline 1 October 2006 & Machine 3 and 4 & Purchase & Kshs. 152,000 each \\ \hline 30 June 2008 & Machine 3 & Sale & Kshs. 126,400 \\ \hline 1 July 2008 & Machine 5 & Purchase & Kshs. 200,000 \\ \hline \end{tabular} Each machine was estimated to last 10 years and to have a residual value of \( 5 \% \) of its cost price. Depreciation was by equal instalments, and it is company policy to charge depreciation for every month an asset is owned. Required: (a) Prepare: (i) Machinery Account (ii) Provision for depreciation to show total depreciation on Machinery for each of the years 2006, 2007 and 2008; (iii) The income statement and statement of financial position extracts for each of the years 2006, 2007 and 2008. (iv) Show the profit or loss on the sale of Machine 3 in 2008. (b) Contractors Ltd. depreciates its vehicles by 30\% per annum using the diminishing balance method. What difference would it have made to annual reported profits over the life of a vehicle if it had decided to depreciate this asset by \( 20 \% \) straight-line? (Total: 15 Marks)

View Answer
divider
BEST MATCH

Chapter three — Be able to discuss: a) How did the agricultural revolution affect myth? What is ritual and what are two key components of it at this time? (42-43) Is Mythology used as an escape from the world? Explain....Eleusinian Mysteries; mystai; What is the newly qualified optimism in Agriculture and agricultural rites?

View Answer
divider
BEST MATCH

The First Five Questions are Matching - Use each of the following choices only once: Converting external energy into an [Choose] internal perception is a good example of the process of Most of our recollections are for the [Choose] "gist" of the information, and are not like a recording - the process of leads to this tendency of our recall to focus only on crucial elements for the event. The process of leads to recollections which are more like a reconstruction - which may include additional information relevant to the the [Choose] theme of the memory. What we commonly refer to as "memory" most closely resembles [Choose] Comprehending what another person is [Choose] saying is an example of the process of input.

View Answer
divider
BEST MATCH

(25pts) Apply the Conjugate Gradient method to find the solution of the following linear system ([3,1],[1,3])x=([1],[1]). Use the initial guess x_(0)=[0,0]^(T). 4.(25pts Apply the Conjugate Gradient method to find the solution of the following linear system Usc the initial gucss Xo=[0,0]T.

View Answer
divider
BEST MATCH

Q1) A vacuum-propelled capsule for a high-speed tube transportation system of the future is being designed for operation between two stations A and B, which are 10 km apart. If maximum acceleration and deceleration are to have a limiting magnitude of 0.6g and if the velocities are to be limited to 400 km/h, determine the minimum time $t$ for the capsule to make the 10 km trip. [CLO 1, PLO 1] A 10 km Figure Q1 B Q2) The center of mass G of a high

View Answer
divider
BEST MATCH

Name: Page > of 3 ZOOM + MTH 112 Activity 9: Simple Linear Regression Research Question: Does the temperature along the migratory route of bird species have an impact on the date on which those birds arrive in Massachusetts? Data: To simplify the analysis, we will focus on the average monthly temperature in Baltimore in April and the arrival date of the Black and White Warbler in Massachusetts. Each of these is recorded from 1940 to 2013. This data was provided by Dr. McCrimmon and Dr. Luscier from the Le Moyne Biology Faculty. Explanatory Variable: Response Variable: Step 1: Define the model: Step 2: Fit the model Coefficients Unstandardized Coefficients Standardized Coefficients B Std. Error Beta t Sig. 168.649 8.695 19.397 .000 -1.009 .160 -.596 -6.292 .000 Model 1 (Constant) Baltimore Temp a. Dependent Variable: Black and White Warbler What is the fitted regression line? Step 3: Check model assumptions.

View Answer
divider
BEST MATCH

In discussing radical halogenation, the following image was presented: Hydrogen abstraction (in the chlorination process) Hydrogen abstraction (in the bromination process) Potential energy Alkane + :Cl• 1º radical Potential energy 2º radical 3º radical Reaction coordinate Alkane + :Br• 1º radical 2º radical 3º radical Reaction coordinate The difference in energies of the primary, secondary and tertiary radicals are the same whether it's chlorination or bromination. Why are the activation energies to each type of radical so different when comparing chlorination to bromination (the green box area).

View Answer
divider