Home
Ask directory
Biology
October 2021
2
Biology
Q&A Archive of
October 2, 2021
Select Question
October 2 of 2021
The CRISPR-Cas9 technique uses the Cas9-guide RNA complex. Explain the importance of the programmable guide RNA. 'Programmable' means that the researchers can create the sequence achieving the researchers' goals when they are utilizing the CRISPR-Cas9 technique. Consider an individual with the…
Hls NSTt meant Iite change in 035 books within (xo test butrs tnt ccltbaned equal 42. AnhlSAt omrlty esart Jebt; Oriee (ect tubs was kept I7 the dark. Mne fesuis ere smoues 0t Batt twutakt motathaec. JTela Hral 4l (1 what is the dependent variable Study? dashed represents results from the tube…
16. Which of the following chromosome numbers characterizes aneuploid (not polyploid) human cell? A. 45 chromosomes B. 47 chromosomes C. 69 chromosomes D. 92 chromosomes E. 23 chromosomes 17. Which statements are correct? A. Viruses contain DNA and RNA. B. The DNA of bacteria is…
If the characteristic in the pedigree is autosomal dominant rare; and subject to complete penetrance; what is the probability the next child of individuals Il-1 and Il-2 will be affected? 8 5 8 1/4 1/2 3/4 1/8
Cambrian Jurassic Carboniferous Hadean period? illustrated by the diverse fossil record.
Explain the mechanisms of pathogenesis of this organism: (How does this organism cause disease?). (4)
What must be the output flow value of an AaBbCcDc genotype if each locus exhibits allele interactions as in situation 17?
Why is it advantageous that checkpoints evolved during the cell cycle? Refer to the figure on the right: Determine the phase of cell A. Determine the phase of cell B. Which of the cells will be haploid at the completion of the division? Explain your answer.
3) 3 pts. Approximately where along the x-axis would SNP "T" be located? A) Position A B) Position B C) Position C D) Can't be determined from information given. 4) 3 pts. Approximately where along the y-axis would SNP "T" be located? A) Position A B) Position B C) Position C D) It could be at…
According to the model, glucose undergoes the following changes during cellular respiration: each step produces NADH or FADH_. Is glucose being oxidized or reduced during cellular respiration? Explain your reasoning. Glucose -> Pyruvate -> acetyl-CoA -> carbon dioxide. Historically, the term…
If the trait in the pedigree below is autosomal recessive and subject to complete penetrance, what is the probability that the next child of individuals Il-1 and Il-2 will be affected? 5 8 1/4 1/3 1/2 3/4
QUESTION 16 If the trait in the pedigree is autosomal recessive and subject to complete penetrance, which of the following is true? 8 Individual 1-2 must be heterozygous Individual 1-2 might be heterozygous Individual Il-3 must be heterozygous Individual Il -3 might be heterozygous
Results Metformin use in the study population and risk of congenital anomaly associated with disease indications We recorded 53,689 babies affected by congenital anomaly in the EUROmediCAT database (2006-13), out of 892,482 births surveyed, across the registries that were eligible to take…
3 tanewe" 6 8 1 that it contains With 1 half life digitacy to the 250 years: right of the decimal. What percentage point; odchact eadojos! the be 96 sign ] lele Jaie H
Zone of inhibition Chlorine O-phenylphenol Hexachlorophene Quat Staphylococcus aureus (gram-positive) Escherichia coli (gram-negative) Pseudomonas aeruginosa (gram-negative)
The respiration rate of a mouse is found to be 0.058 mL O2/g-min. If this mouse weighs 29.8 grams, what volume of oxygen will this mouse consume in 0.75 hours?
Organic acids such as potassium sorbate, sodium benzoate and calcium propionate are added to many of our foods? They are interfering with the growth of many molds and some bacteria by (p. 191-192, ed. 12; p.194-5, ed. 13).
Hydrogen peroxide, peracetic acid (PA), and ozone share a mechanism of action (p. 194, ed: 12; p. 196-7, ed. 13). What is the mechanism of action of hydrogen peroxide, PA, and related compounds? Hydrogen peroxide is considered not to be a good antiseptic. What enzyme do humans produce that…
Q4) Via the action of the ribosome, what type of bond is created as one amino acid is linked to another? This bond creation is happening in what step of translation? This linking of amino acids together in a particular sequence is generating what level of protein structure before chaperonins…
What is alcohol's mode of activity? This would include ethanol and isopropanol (p. 189-90, ed: 12; p. 192, ed. 13). To help you, consider: What does ethanol do more efficiently when used at 70% concentration as opposed to 100% concentration? When skin is swabbed, how does ethanol work here?…
Choose the option below that contains the correct complementary DNA sequence to the following: 5' - AAGTCATTGCCGTA -3' 5' - UUCAGUAACGGCAU - 3' 5' - TTCAGTAACGGCAT - 3' 3' - UUCAGUAACGGCAU - 5' 3' - TTCAGTAACGGCAT - 5'
First, complete the reading and review Table 12.1. Next, identify all environmental conditions to which bacteria can adapt: Select all that apply: A low concentration of amino acids A high density of cells Shortage of reduced nitrogen Shortage of amino acids UV light-induced damage to the…
Data Table 2. Gram Staining Results Slide Photograph Microscopic Image Observations S. cerevisiae Gram negative bacilli, in red Body sample Gram positive cocci in purple arranged in grape-like clusters. Questions A) Describe the difference between Gram-negative and Gram-positive bacteria. Which…
Gene structure Bacterial Eukaryotic Purpose/Function? Gene? gene? Promoter Introns Stop codon 5' CAP TATA box -10 and -35 box Template strand Transcription start site Terminator +1 site Start codon Exons Ribosomal binding site Non-template coding strand
Label the structures in the image, which shows translation.
Place the events of protein synthesis into the correct order on the right: First DNA RNA polymerase uses DNA template strand to create complementary strand of mRNA TRANSCRIPTION mRNA leaves the nucleus Nucleus TRANSLATION RNA molecules transport amino acids to ribosome Ribosome Polypeptides…
Which of these hypotheses is falsifiable? There is intelligent life on other planets. The Moon is made entirely of cheese. Isaac Newton was the greatest scientist. There is beauty in art. There is cheese on the Moon. Bethany wanted to know if cookies baked with gluten-free flour and rice flour…
The biological species concept focuses on the ability of organisms to exchange genes. True False
TABLE 4 (CONI) Unilateral Platelet Count Glutathione Ordane Stretch Bedrest Glutamine On90 Treatment Duration Calculation Accuracy Acetaminophen Escherichia coli Negative Negative Dose Negative Negative Facultative Negative Peg/Negative …
What factors influence the levels of sex hormones, including testosterone, in men and women? Select one: a. Sexual activity b. All of the above c. Intimate social interactions, such as cuddling d. The hypothalamic-pituitary-gonadal axis
Which of the following is false regarding PCOS? Select one: a. PCOS usually occurs in women with high androgen levels b. Women with PCOS can suffer from dysmenorrhea c. PCOS is a common cause of ovarian cancers d. Ovulation may not occur in women with PCOS e. PCOS is the most common cause of…
Imagine that you transfer 10 actively growing bacteria to a fresh agar plate. Two and a half hours later, you look at them through a microscope and there are now 320 bacteria. What is the generation time of these bacteria? 30 minutes 16 minutes 160 minutes 10 minutes 60 minutes 37.5 minutes
The theory of evolution: persons with their contributions to the development. Match each: James Hutton [Chose transmutation of species developed gradual theory mistakenly claimed it would not result in speciation for natural selection. Described uniformitarianism. Encoded animals provided…
The bacteria in the Gram stain depicted above would most accurately be classified as: staphylococci streptococci sarcinae diplococci single cocci diplobacilli tetrads staphylobacilli
Which of the following can cause hypoactive sexual desire disorder? Select one: a. A decrease in factors that make sex desirable. b. An increase in factors that make sex undesirable. c. Two of the above d. A, B and C all contribute to hypoactive sexual desire disorder. e. A lack of interest in…
Helicobacter pylori is a Gram-negative spirillum that can grow in the human stomach. It can cause stomach ulcers and, in severe untreated cases, even cancer. Select all of the correct possible classifications for H.…
Imagine that you transfer 10 actively growing bacteria to a fresh agar plate. Two and a half hours later you look at them through a microscope and there are now 320 bacteria. What is the generation time of these bacteria? 30 minutes. 16 minutes 160 minutes 10 minutes 60 minutes 37.5 minutes
In northern Europe, a species of daffodils in Hardy-Weinberg equilibrium (generation 0) suddenly begins selfing: What would be the genotype frequencies in the third generation of selfing if the initial allele frequencies were: A-0.5, a=0.5?
Numbers of individuals Flower Species Sample Sample 2 Daisy 300 Dandelion 335 Buttercup 365 931 Total Individuals 1000 1000 Table source: hutp/lww countrysideinfo.co.uk/simpsons/hlm In Sample and Sample 2, species richness is three because there are three flowering plant species represented in…
The population of deer is divided by a road. When the road has no traffic, some deer cross it and migrate from the population south of the highway to the population north of the highway. In 2013, the individuals who successfully migrated were 40, joining a population of 160 northern deer. The…
1. What is the best birth control for you? For this prompt explain what type of birth control you would choose if you needed a method of birth control: Why would this be the best method for you? What would you take into consideration before choosing this method? Are there any side effects or…
If you wanted to find an encdlomucin resistant coli, what would you do next? First, isolate a colony of bacteria from the streptomycin positive plate and grow it on qucolamtdn positive plate. Then, isolate a colony of bacteria from the streptomycin positive plate and grow it on Ted DMicin neoa…
IS a Bedlam common question. The red plug. Mia (+ or -)? Once you turn on the power supply, how do you know the current is running? Step 5. Stain gel and analyze results. What is the chemical used to stain the DNA in the gel? How does this stain work? Is this stain harmful to your DNA? Should…
How many net total ATPs are produced from complete oxidation (meaning 8 oxidation citric acid cycle and OXPHOS) of the 17-carbon unsaturated fatty acid below? Show your work: how many acetyl-CoA units are made, ATPs consumed/produced, NADH and FADH2 molecules produced in the process.
A DNA chain is a sequence of chemicals called bases. There are four possible bases: thymine (T), cytosine (C), adenine (A), and guanine (G). a. How many 10-element DNA chains are possible? b. What fraction of these chains have exactly thymine and cytosine each occurring exactly twice.
clpl DH H oH bH 4 'Cy QQ ~u tpoocchar de vaina Hq peles uaed U Fa 4.45 @ nd Wth doeluatiioos (Methodl WD d= Cuesed Uh clcuo) ,
4. Google "armadillo recipes." How is armadillo prepared and eaten? Could undercooked armadillo play a role in foodborne transmission of M. leprae? Explain.
Monocercomonoides are genus single-celled organisms that live as parasites in the guts of small animals. They lack mitochondria, but other evidence shows them to be most closely related to the excavates. Looking at the tree for eukaryotes, what can you conclude about Monocercomonoides? Choose…
Eukaryotes Chordates Reptiles and Birds, Mammals Ecdysozoa Opisthokonts Deuterostomes Match each of the options above to the items below. Notochord Endoskeleton Nucleus + mitochondria Single flagellum Amniotic egg Ecdysis
In northern Europe, species of daffodils in Hardy-Weinberg begin selfing. What would be the equilibrium (generation 0) suddenly initial allele genotype frequencies in the third generation of selfing if the frequencies were: A-0.5, a-0.5? What is the effective population size of a population of…
clpl DH H oH bH 4 'Cy QQ ~u tpoocchar de vaina Hq peles uaed U Fa 4.45 @ nd Wth doeluatiioos (Mctlodl WD d= Cuesed Uh clcuo) ,
The bacteria was susceptible to streptomycin: The bacteria does not need streptomycin to grow:
Rice plants will start to flower when daylight duration shortens. However, flowering is delayed in hd1null mutant rice even under short days. This evidence is a test for none of these requirements: sufficiency or correlation.
Which of the following statements is true about the bacterial DNA represented at arrows "A" and "B" in this image? The DNA at B is not essential for the cell to grow and function. The DNA at B is the cell's nucleus. The DNA at B may contain genes that make the bacteria resistant to penicillin.…
A scientist conducted an experiment to investigate the effect of fertilizer on plant growth rate. Plants A, B, and C were watered every day with pure water, water containing 10mg of fertilizer, and water containing 20mg of fertilizer, respectively. In this experiment, the independent variable…
Rice plants will start to flower when daylight duration shortens. However; flowering is delayed in hdlnull mutant rice even under short days. Which of the following statements supported by this evidence? The function of Hd1 is to inhibit flowering under long days, The function of Hdlis t0…
2 3 5 9 4
Question 23 The ciliated slipper-shaped protozoa that you have learned about in the handout, class, etc. is ____ and it carries out sexual reproduction where its genetic material is exchanged between two of these protozoa via the process ____: a. euglena ; transformation b. paramecium ;…
Jata practical alternative assignment: Acid phosphatase activity with increasing concentrations. Acid phosphatase assay uninhibited. Nitrophenol absorbance at 405nm. Sample blanks. Concentrations (mM): 352 409 055 508 568 557 Acid phosphatase assay in the presence of unknown…
Question 11 Supposing Alexis (son of Nikolas who had Alix) lived and married a normal woman, what are the chances that his daughter would be hemophiliac? What are the chances that his sons would be hemophiliacs? 50% for both daughters and sons 50% for females; 0% for sons 0% for both daughters…
Using the "Choose Your Foods Booklet," determine the number of calories in the following meal: 4 ounces of corned beef, 1 cup of peas, 8 ounces of baked potato, and 6 ounces of apple juice. (Only enter numbers. Your answer should not contain any words.)
According to The State of Obesity 2018, which statement is false about obesity rates? Women had lower rates in 2015-2016 than men. Colorado has the lowest obesity rates in the country. There are indications that rates of obesity and severe obesity have declined from 2010 to 2014 among 2 to…
Give the name of the green algal group that contains the closest relative of plants. Then, list three derived traits that plants have that this group does not have.
Fixed Greylag Retiler 1 Kinesis action Group action movement will continue. Geese will behavior pattern retrieve 2 42483, 3843 was displaced removed H thaero into rolling movement: the nest with its beak. The beak.
Disappearance of M gene: true deuteranopia. Mutated M gene 'shifting its absorbance towards the photoreceptor: deuteranopia due to anomalous trichromacy (deuteranomaly). Below you can observe how individuals affected by these mutations would see colors: 9296 2.7% 0.66% 0.5996 0.5696 Normal…
Ecological Economics is the study of reorganizing markets to promote long-term ecological health, production, and consumption activities of humans in ways which principles of stability and sustainability of natural systems upon which we depend are included within this framework. Which of the…
Put the items in the correct order from the strongest bonds strength to the weakest: ionic bonds single covalent bonds hydrogen bonds van der Waal interactions double covalent bonds triple covalent bonds
What is the selective pressure applied during the mechanism associated with the development of drug resistance by viruses? a. The virus b. The immune system c. The drug d. A and B e. B and C
(Gift) The genus Homo first appeared in the _______ epoch, while the species Homo sapiens first appeared in the _______ epoch. ? Paleocene, Pliocene ? Pliocene, Pleistocene ? Eocene, Miocene ? Miocene, Holocene
Dated at 23 mya Africa; the earliest fossil hominoid (ape) known thus far is: Proconsul Carpolestes Aegyptopithecus Sivapithecus Actcobus
Plant Width Percentage of Vegetable Cell Nucleus # In the image of the of the along with the count, the plant that; the magnification: the regardless ruler right EZ and 8 rh Determine on the of how the width field the Wi of stained determine 3 E; 3 plant 1.5
The summary formula for photosynthesis is: CO2 + 6 H2O = C6H12O6 + 6 O2. Which side of the chemical reaction (reactants or products) has the most entropy? Which molecule has the most potential energy? Is this reaction endothermic or exothermic? Spontaneous or nonspontaneous?
Lowest table magnification: power of magnification HL Lens Information about the 041 ocular Magnification 2 objective the Total lenses compound Magnification on microscope microscopes.
Epithelial cells in the kidney reabsorb glucose from urine and return it to the bloodstream in a manner very similar to what happens in the intestine during absorption of food nutrients. It is known that the reabsorption of glucose into the epithelial cell from the urine is dependent on sodium…
Epinephrine is released by the adrenal gland in times of stress and signals muscle cells via a G-protein coupled receptor to break down glycogen so the resulting glucose can be oxidized for energy. (8 pts) Describe in detail how epinephrine signals the breakdown of glycogen. Include the…
An mRNA has the sequence 5' GCCACCAUGGGGGGAAGGUGAAGACC 3'. (3 pts.) Write the sequence of template and nontemplate strands of the gene encoding this mRNA. Clearly indicate which is which and include 5' and 3' polarity. Change the font (where it says paragraph above) to "preformatted" to get a…
You want to measure the blood oxygen level in a drop of blood using a pulse oximetry device. If you have a light source at 700nm and a path length of 1mm, what must be the concentration of oxidized hemoglobin (HbO2) in the blood so that the light intensity at the output decreases to one-tenth…
The lac operon (6 pts) What are operons and in what organisms are they found? What advantage do cells with operons gain? What potential disadvantages might be associated with operons? (8 pts) The table below depicts the expression of the lactose operon under three growth conditions. Describe…
The tetrodotoxin found in puffer fish is a toxin because it Select one: a.is a mutagen b. accelerates heart rate accelerates destruction by free radicals_ d. stops glucose metabolism_ e. blocks sodium channels_
The primary use of in vitro evolution is to Select one: a. determine the evolutionary history of gene families. b. study protein function. c. identify new diseases. d. take advantage of naturally occurring biomolecules. e. produce new molecules.
Leader 0 polymerase chain reaction (PCR) What is the purpose of performing PCR? How many times should PCR be performed? Are the primers used for single-stranded DNA or double-stranded DNA? What is the enzyme used in PCR? What is the special property that makes PCR a miracle?
The picture below shows agarose gel electrophoresis of various DNA samples. Which side is the positive end? Which DNA molecule is smaller in size, 8 or 1?
6. Predictions of the emergence and spread of antibiotic-resistant bacteria could play a role in public health intervention contexts. The conceptual framework we've outlined here can be formalized into an even more extensive computational simulation, where the equilibrium frequency of…
The genetic variation we observe between antibiotic-sensitive and antibiotic-resistant bacteria likely derives from (Select the most correct term): Natural Selection Evolution Mutation Phenotype
uring cardiac cycle valves must open and close at the proper time to allow proper blood flow: atrioventricular valves are open during atria and ventricular diastole b. atrioventricular valves close at beginning of ventricular systole semilunar valves open towards the end of ventricular…
Pith Primary xylem Vascular cambium Primary phloem Cortex Epidermis Epidermis Cortex Primary phloem Vascular cambium Primary xylem Secondary xylem Secondary phloem First cork cambium Pith Cork Secondary phloem Secondary xylem Cork Growth
Organ Systems Working Together Glucose Oxygen ATP Carbon Dioxide Water Circulatory System Digestive System Respiratory System
In the classification system devised by Linnaeus, the names of of plants end with the suffix while those of animals end with Select one: a. families; -idae; -aceae b. classes; -aceae; -idae c. orders; -idae; -aceae d. classes; -idae; -aceae e. families; -aceae; -idae
Why are the two pathways of blood clotting referred to as the extrinsic and intrinsic pathways? Select one or more: the intrinsic pathway refers to clotting factors present within the blood, while the extrinsic pathway refers to clotting factors located outside of the blood.
derived trait is one that Select one: a.is found only in members of the outgroup. b. has the same function, but not the same evolutionary origin, as a trait found in another species c is the product of an evolutionary reversal: d. differs from its ancestral form e. is homologous with another…
In studies of the sensory exploitation hypothesis, which observation would most challenge the validity of the hypothesis? Select one: a. The female preference for swords had evolved after swords evolved in males. b. The female preference for swords had evolved before swords evolved in males. c.…
Which is an important application of phylogenetic analysis in fighting infectious diseases? Select one: a. Determining when a pathogen first infected the human population b. Identifying when a new form of the pathogen emerges in the human population c. Tracing the different forms of the…
Considerng that glycolysis yields much less energy compared with mitochondrial respiration, Warburg hypothesized ihat mitochondria must be dysfunctional, and this is the initiating factor cancer formation_ Based your understanding the hallmarks cancer does dysfunctional mitochondria benefit…
Part II - Diagnosis and T cells activation Baby Joe' $ doctors diagnosed his condition as severe combined immunodeficiency (SCIS) This is a rare disease that can be life-threatening; without treatment; it is usually fatal in childhood. SCIS can be caused by several genetic mutations. In Joe's…
0 0 0 Which IN of Gene Bioreactor Pathogen 2 the the therapy above resistance following 2 0 trait engineered Into crops 7
Notochord Urochordata (tunicates) 1. Common Myxini ancestor of (hagfishes) chordates 2. Petromyzontida Head (lampreys) 3. Chondrichthyes (sharks, rays, chimaeras) 4. Vertebral column 5. Actinopterygii (ray-finned fishes) 6. Jaws mineralized skeleton 7. Actinistia (coelacanths) 8. Lungs or lung…
Activity 12. Tubulinids View prepared slide of Amoeba proteus. Label the following structures: nucleus, pseudopodia, endoplasm, ectoplasm, cell membrane, food vacuole. Activity 13. Entamoeba View prepared slide of Entamoeba histolytica depicting cyst and slide depicting trophozoite. Designate…
Assume that a polygenic character in Drosophila is produced through the activity of five genes, each with two alleles. Two individuals who are both heterozygous for all five genes are crossed. How many different genotypes are expected in the offspring? 729
Valine Glycine Leucine Leucine Histidine Arginine Threonine GGA GUG UGU CGA ACA CAC CUU CCG GGA CCU CUC CCG AU AU }x
Ecosystems are the interactions of organisms with one another and with their environment. Fill in the levels of organization (from largest to smallest) and describe each. How is a population different from a community? Name at least biotic and abiotic factors in the ecosystem (refer to…
pathogen B cell helper T cell nucleus white blood cell
Dandelion seeds get dispersed by the wind and can grow almost anywhere What type of population distribution would yU expect to see for dandelions? Clumped Random Uniform
Moray eels will open their mouths and allow special shrimp to come in and the parasites living eat in their mouth_ The shrimp enter for their meal confident that the cel will not eat them Why wont the eel cat the shrimp] b: What type of symbiotic relationship is this? Align
Question 12 example Turbomans PREVENT. SLOWDOWN evolution; For the [00/305, press ALT-FidiPoo = ALT-En+Fio (Mac) Pamgna (1201) Path: D QUESTION 13 Female birds and frogs can recognize [ @ calls of specific males (males Gdcd Uns can example or: beloma SpedeflandInus & old Frondidng Pre-zygotic…
QUESTION 3 What can be said about speciation? It is process_ It is instantaneous: It cannot be reverted. Two options given here are correct:
3. Explain how interspecific competition can drive evolution
In eudicots, the growth of axillary buds is inhibited by auxin produced in the apical meristem b the shade created by the adjoining leaf auxin produced in the adjoining leaf blade_ excess cytokinins produced in the root none of the above
According to "The Trees that Miss the Mammoths," the seeds of this common NYC street tree may once have been dispersed by Pleistocene megafauna: Gleditsia triacanthos, Quercus palustris, Ulmus americana, Ginkgo biloba, Platanus acerifolia.
In human adults, as part of physiological processes such as wound healing and female reproductive cycling, angiogenesis is turned on. What do you think is the fundamental difference between angiogenesis turned on during the normal physiological process and during cancer progression? (3 points)
Gnastic movements are oriented towards a stimulus. They can occur without any kind of stimulus, involve growth, are reversible and repeatable, or do none of the above.
In Farmer & Ryan (1990), the stressed plant produces methyl jasmonate, and then neighboring plants produce proteinase inhibitors, glandular trichomes, toxic alkaloids, and lipid-rich rewards for ants. None of the above.
Chemicals that ' reduce plant digestibility include cellulose_ Oa lignin. tannins silica. all of the above
The mycorrhizal networks that link trees in forests are thought to be important for forest health. According to Beyler et al. (2009), network analysis has hypothesized that these networks influence seedling establishment, drought resistance, pathogen resistance, and tree mortality.
DNA is anti-parallel, which means purines bind to pyrimidines. Bases are held together by phosphodiester bonds. There is a sugar-phosphate backbone. One strand runs 5' to 3', and the other strand in the opposite direction.
In woody plants, unusually narrow annual growth increments indicate that a tree was attacked by the woolly adelgid. Additionally, periods of adverse conditions, including prolonged drought, are only created right before a tree dies. These increments are formed when saplings are released from…
The idea that plants are able to "hear" is controversial; but one study suggests that when evening primrose detects vibrations from visiting pollinators, the plants demonstrate a nastic response and turn the petals to face the pollinator. They also increase sugar concentration in the nectar,…
Potential benefits of frugivory include a. the seed coat is scarified. b. germination inhibitors in the fruit pulp are removed. c. "fertilizer" is deposited with the seeds. d. all of the above. e. none of the above.
(ii) State the diameter of the pore labelled X [1]
Which of the following is NOT a terpenoid? a. rubber b. saponin c. vanillin d. essential oil e. none of the above; all are terpenoids
Researchers at SUNY College of Environmental Science and Forestry are engineering a blight-resistant American chestnut tree by introducing a gene for bacterial resistance. There are dozens of genes involved in resistance in the Chinese chestnut, including a wheat gene that breaks down the…
One herbivore feeding strategy that is likely to create a strong negative selective pressure on a plant is granivory. Other feeding strategies include gallmaking, nectarivory, frugivory, and detritivory.
Plants acquire information about the time of year by detecting a. the position of the stars. b. changes in wind intensity and direction. c. the length of the night. d. all of the above. e. none of the above.
According to Beyler et al.'s (2009) network analysis of Douglas fir trees and mycorrhizal fungi, large mature trees a. were colonized by just one or two fungal genets. b. were frequently linked to other trees, including less mature trees. c. were considered hubs because they monopolized…
Outline the various processes of altered cellular growth including hypertrophy; hyperplasia, dysplasia; in situ cancer and invasive cancer: Compare and contrast the similarities and differences biological behaviours between malignant and benign tumors.
From the information given above, her nasal secretion reduced and became clear after taking Augmentin plus Tamiflu: Explain why the nasal secretion was cleared initially:
Which of the following plant compounds is NOT an alkaloid? morphine b. cocaine theobromine quinine none of the above; all are alkaloids
Ancestral angiosperms are characterized by indefinite numbers of floral parts b spirally arranged floral parts radially symmetric flowers. separate (unfused) floral parts_ all of the above_
A nocturnal, tubular white flower with a sweet aroma is probably pollinated by carrion or dung flies, long-tongued bees, moths, or flies that mimic bees.
Question 548380 1 H 0 | 1
Asexual reproduction can be disadvantageous because a. all progeny may be negatively affected by minor changes in the habitat. b. some progeny may be able to colonize sites that are not suitable for the parents. c. some progeny may be better adapted to local conditions than the parents. d.…
Seed plants promote out-crossing with spatial separation of pollen and ovules: temporal separation of pollen and ovule maturation_ chemical barriers to pollen germination chemical barriers to pollen tube growth: any of the above.
In many trees, the heartwood is impregnated with phenolic compounds b resists fungal infection: conducts most of the water and minerals. stores carbohydrates does both a and b_
Tomatoes, bananas, red peppers, and blueberries are all examples of a. drupes. b. follicles. c. berries. d. samaras. e. none of the above.
The sign attached to the London Plane tree outside the Marshak building is no longer visible because it has been covered by inner bark and outer bark.
Water-dispersed fruits only germinate near fresh water bodies. They often have geographically widespread distributions and are carried by oceanic water currents. The correct answer is both b and c.
dominant, recessive, way to identify whether an organism is heterozygous or homozygous, organism that is homozygous, phenotype.
Which of the following is FALSE: Acquiring prophage may cause recipient bacteria to make toxins or express genes in the prophage that do not specify viral structural proteins. Prophage is viral DNA inserted into the bacterial chromosome. Prophage may leave the bacterial chromosome. When…
Text: # (10 Subunits 28 1 Alatcordse rdhe ez 1 only ' L be used enzymelproteinlribozyme Telomerase once 8 83 # some words role Ligase the 5= central Riboseme dogused Prerasee "Ile Ie molecular 8 G5e differentiation they pts) DNA involved Pol of function? and wiq # differ? 4loq 1 "specitic #…
Questions What is the arthropod exoskeleton composed of? What characteristics indicate that horseshoe crabs are more closely related to arachnids like spiders than TO Other crabs? Give the stages and an example of complete metamorphosis Give the stages and an example of incomplete…
Consider what the following mutations would do to the catalytic mechanism of chymotrypsin. The specificity pocket remains hydrophobic but becomes more shallow. The aspartic acid in the active site mutated to asparagine. The serine in the active site mutated to cysteine.
13. [5 points] What units are EMG measured in? Explain how these units relate to the physiology of muscle contraction. How does EMG collect this data?
The roan coat colour in shorthorn cattle is the result of codominance of the coat colour alleles. A roan shorthorn mated with a white shorthorn. What is the probability that the offspring will be white shorthorn? Record the answer as a value between 0 and 1, with two significant digits:
Q 6. Based on your test results for the two parents, what ABO blood types are possible among their biological children, and what is the probability of occurrence of each? [1 sentence] Q 7. Based on your answer to Q6, comment on the possible family background of each of the two children, and…
Genetics discussion Work sheet 2 Name: ID: In tomatoes, pear shape, yellow color; and terminal flower position are recessive traits produced by alleles f, r; and t, respectively: The dominant phenotypes for each trait full shape, red color; and axial flower position- are the product of…
7. Consider the problem of comb shape inheritance in chickens, where walnut, rose, pea, and single are observed as distinct phenotypes. How is comb shape inherited, and what are the genotypes of the P1 generation of each cross? Use the following data to answer these questions. Test the results…
37. Which of the following rows correctly identifies the relationship between the blood type alleles IA, IB, and i? A. Relationship between IA and IB: Dominant and recessive; Relationship between IB and i: Multiple alleles B. Relationship between IA and IB: Codominance; Relationship between IB…
If a planet X has a tilt of 18 degrees on its axis, then:
Complete the following table by: (1) matching the appropriate sketch for the phase from the list below the table (note that yellow indicates "lit" while black indicates "dark"); (2) selecting the correct Moonrise/Moonset pairing for each phase (where Moonrise appears first followed by Moonset);…
Andalusian chickens have black and white plumage. They display incomplete dominance in feather colour: blue birds are heterozygous. The white Andalusian rooster mates with a black Andalusian hen. What percentage of the offspring are expected to be blue Andalusians? A. 50% B. 0% C. 100% D. 25%
The physical splitting of a eukaryotic cell is called: duplication binary fission cytokinesis telophase NKOLHRANGHAUHERUHAUSAMAL est checked 3
4. Label the organ of the digestive track on the following diagram noting the major function of each organ.
3. Choose an organ within the digestive track of vertebrates. For this organ you will need to describe what the organ does, any other organs that may be associated with the organ. What happens to your organ when it stops working Or not working properly, and three interesting facts about your…
SIZE (bp) 000 900 800 700 600 500 400 300 200 100 Figure J: Gel electrophoresis image of restriction enzyme [indlll and EcoRI digestion of DNA from varying E. coli transformants. Lane containing 100 bp DNA Ladder. Lane containing uncut Blue colony plasmid. Lane containing Blue colony plasmid…
If you have crackers at home, preferably saltines: 1. Take a small bite of the cracker; holding it in your mouth without chewing or swallowing: After 2 minutes, discuss the answer questions. Why did the cracker begin to get soft in your mouth? What did you taste? After a few minutes did the…
The above procedures are carried out to identify the type of cell respiration in the yeast and interpret the results on yeast reaction by using methylene as the artificial hydrogen acceptor. Answer the following essay questions: 1) Explain in detail the general type of cell respiration in the…
445 PM Wed May 20 100% 5:27:28 Exit You will only look at standing diversity and that way you will not have to do those pesky breeding experiments. Your data end up looking like this: 12 10 8 6 4 2 0 AABB AABb AAbb AaBB AaBb Aabb aaBB aaBb aabb …
The present problems of coolant in machining are the contamination and stains on the workpiece due to the utilization of the cutting fluid. You are currently working in a biomedical engineering company and required to design the machining process for a medical implant, such as a ball joint used…
Look at your food label again to answer the following questions: List the main ingredients in your food item by its type Carbohydrates: Proteins: Lipids: Identify any trans fats in the Ingredients list. Identify any added sugars in the Ingredients list. 10. What surprised you most about the…
Theoretically, what is the expected result from the parental cross of J7 mouse and an albino mouse, and why does the expected result not match the result stated in the information given above? Theoretically, 100% of the mice should have grey coats so all 38 offspring should have grey coats.…
The diagram above depicts the Law of Segregation, complete dominance, crossing over, and nondisjunction.
A. An angiosperm plant has specific mechanisms to prevent self-pollination. Define the process and its types. How do you cross two distant plant species? Explain with suitable methods. What are the screening techniques you know to analyze them in different stages of development? (2+5+3-10…
Rainfall log(N) Year Questions During which time interval years does the survival of each cohort of G. Laeeca have the steepest slope on the graph? Where is the slope of the line highest? Can the environmental factor of rainfall influence survival in occurrence and/or number? Explain. Consider…
social consequences of doing science: Pretend you are a member of an international bioethics committee determining rules on gene therapy: The committee is trying to decide whether fatal genetic diseases with no current cure like Huntington'$ disease should be allowed to be removed from the…
Which of the following results in genetically diverse cells? No answer text provided_ WM No answer text provided Meiosis Mitosis
Question 1 When do fossils resembling modern Homo sapiens appear in the fossil record in Africa? (approximately) 160,000 ya 60,000 ya 600,000 ya 1.6 mya Question 2 Anatomically modern humans have a vertical forehead a prognathic face enlarged canines a prominent brow ridge
When Mendel crossed purple-flowered pea plants, he never got offspring with flowers that had an intermediate color.
1 2 3 Do 4 5 Ooc
Haetonf ttrtfon Tnsu u upright = e4r3 Use tn floming tur colour t hlch coly (M dorrunuint @urabba #hile homozygous dominant Ove flappy Gara (U) mlad tn Ior both traits heterozygous atyte rabbit with Upright ears Leto mboit Kh nopPY "ar What are the possible phenotypes = White Ippy and black…
Annelids are the most simple organisms that have a body cavity What is the purpose of body cavities in animals who have them? (Circle one or all that apply) Provides space for organs to grow Allows organs to be independent from the outer body wall Provides the ability for organs to evolve…
CGQTIAH T 1975 cohort of John Lennon/DZR calculate The much Successful leadership Earth; Unusually To visualize that the Eradic - data JTE survivoship Human Hahle the right = Canac c stickers (found ~survivorship the 1975 cohort hundredths place - CIAIC Tbk the grid below Glic= sndcrs. Make…
Two-photon microscopy uses long-wavelength light, and therefore two photons instead of one are needed to excite the fluorochrome to emit light. The differential stains most frequently used for bacteria are crystal violet and methylene blue.
Match the definitions with the terms (not all terms will be used; yes you can use your notes). Allele that is seen even if present with the recessive form: Dominant Another word for egg and sperm cells: Gametes Units of hereditary information (codes for one protein): Genes Two identical…
According to the cell wall components, there is differences between Gram positive and Gram negative bacteria_ 8- Penicillin inhibits peptide bridges in peptidoglycan in the cell wall of bacteria_ 9-
Grm Positive Gnm Negative RoDS CoccE aaoTHOHMac Oma MEOATIE POSITIVE
Question 10 Match the reagent with it's function. Provides a source of nitrogen for the cells for cell growth, but it is unstable, particularly at 37 °C To control bacterial contamination in the cell culture Provides a source of carbon and vitamins for the cells and is stable at 4 °C Stains…
44. Proteins (the amino acids) contain all the following elements EXCEPT a. Carbon b. Nitrogen c. Phosphorus d. Hydrogen e. Sulfur
QUESTION 25 EXERCISE 5; DNA EXTRACTION 25, 26,27. Question 25. The cell wall of a strawberry cell (or a plant cell) is made of the following: Oa Lipids Ob. Albumin Cellulose d. Starch QUESTION 26 26. How many barriers (number) need to be broken to ease the DNA from inside of strawberry cells
Table 5. Frequencies of alleles (bins) for hyper-variable VNTR loci in Caucasians VNTR Locus DIS7 Binned Allele 605 372 802 563 601 Frequency 0.004 0.006 0.009 0.012 0.011 VNTR Locus D2S44 Allele 0.007 0.009 0.014 0.007 0.016 Frequency 0.020 0.011 0.014 0.010 0.029 …
Question 3: According to what you have learned, compare the process of RNA transcription from DNA between eukaryotes and prokaryotes. points) Question 4: Explain brielly: some antibiotics are designed to target protein synthesis in bacteria without harming protein synthesis in human cells. (2…
The figure below shows a slide of duodenum. The arrow labelled 'A' is pointing to which type of tissue? Select one: a. Muscle tissue b. Nerve tissue c. Epithelial tissue d. Connective tissue
QUESTION 36 36. Cellulose is a ______ whereas enzymes are ____ QUESTION 37 37. Nucleic acids in cells serve the purpose of
The error rate (wrong base pairing) during DNA replication is controlled by ? A.) DNA polymerase III proofreading B.) 3' -> 5' activity of DNA polymerase III C.) the effectiveness of primase D.) effectiveness as ligase
27. Identify the barriers in the right order (outside to inside). a. Cell membrane, cell wall, nuclear membrane b. Nuclear membrane, cell membrane, cell wall c. Cell wall, cell membrane, nuclear membrane d. Cell membrane is the only barrier to be broken to release the DNA. Which of the…
QUESTION 32 32. Starch a. Present in animal muscles b. Monomer unit of proteins. Storage form of energy molecules (glucose) in plants. d. Table sugar. e. Monosaccharide. QUESTION 33 33. Amino acid a. Present in animal muscles. b. Monomer unit of proteins. Storage form of energy molecules…
EXERCISE 5: DNA EXTRACTION 25,26,27. Question 25. The cell wall of a strawberry cell (or plant cell) is made of the following: 0 a Lipids 0 b. Albumin Cellulose Starch QUESTION 26 26. How many barriers (number) need t0 be broken to release the DNA from inside of strawberry cells c.3 d.4
QUESTION 22 Which one of these hominin traits was observed first with some of our earliest hominin ancestors (e.g. Sahelanthropus tchadensis and Orrorin tugenensis)? - speech - agriculture - bipedalism - material culture Question 2: Denisovans are more closely related to modern humans than…
According to the scheme above, a mutation results in a defective enzyme A. Which of the following would be a consequence of that mutation? Explain your answer. a - an accumulation of A and no production of B and C b - an accumulation of A and B and no production of C c - an accumulation of B…
Illustrate the basic structure of an antibody and highlight the Fab and paratope. (10 marks) 2. Corrected_text: A testing lab recently developed a new kit for rapid detection of chloramphenicol in milk. The rapid testing kit contained the following: - Strip with sample window and test window -…
Text: Question Completion Status FIGURE 2 for Q 18, 19, 20, 21 18. A in FIGURE represents the process of Translation; protein that allows the construction of Transcription; protein c Translation RNA (messenger RNA) Transcription; RNA (messenger RNA)
Disaccharides such as lactose and maltose have unique metabolic pathways to oxidize their carbons completely to carbon dioxide, and these pathways are independent and do not involve the impact of glycolysis. True False The carbons of acetate that enter the citric acid cycle are expelled…
21. Surprisingly, the human genome contains fewer genes than expected. How, then, is the human genome more complex than that of other organisms? A) Post-translational processing adds diversity to the resulting polypeptides. B) RNA transcripts of human genes are more likely to experience…
An RNA molecule has the sequence 5'GcahUGcAAJZ. What is the sequence of the gene in the DNA? A) 5'Gcaatgcaa-3' B) 5'(GttcacottaX C) 5'-66ttacgtt-3' D) 6-TTGcattgc-3
11. Mitochondria a. Uses glucose to generate cellular energy b. An internal vesicle with digestive enzymes c. Ribosomes d. Uses solar energy to generate glucose e. Packaging center of the cell 12. Chloroplasts a. Uses glucose to generate cellular energy b. An internal vesicle with digestive…
How many molecules of ATP can eukaryote make from complete oxidation of one molecule of glucose?
What representative bacterial Genus is endospore forming, Gram positive, obligate anaerobe? Clostridium Mycoplasma Mycobacterium Pseudomonas Bacillus
QUESTION 8 Cells of the testis which constantly makes testosterone (a STEROID hormone) is rich in Smooth ER 0 b. Rough ER
Which culture produces the most lactic acid? coli growing glucose broth at 35°C with O2 for days coli growing glucose broth at 35°C with O2 for days AND coli growing glucose broth at 35°C without O2 for days None of the choices are correct coli growing in glucose broth at 35°C with O2 for…
The 5'-carbon of DNA refers to where a nitrogen-containing base attaches, the position on the sugar component of a nucleotide, the phosphate group, where methionine attaches, and the start of where complementary pairing begins.
Generally, antibodies recognize and interact with specific regions on antigens called PAMPs active sites haptens all of the choices are correct epitopes
Snoath V constantly makes 1 b. False M 1 have 1 1 PROTEIN hormone] 1 ; specific functions structured inside eurynCric membrane (answer LUES and 8}: 1 Wnicn
The CRISPR-Cas9 technique uses the Cas9-guide RNA complex. Explain the importance of the programmable guide RNA. 'Programmable' means that the researchers can create the sequence achieving the researchers' goals when they are utilizing the CRISPR-Cas9 technique. Consider an individual with the…
16. Which of the following chromosome numbers characterizes aneuploid (not polyploid) human cell? A. 45 chromosomes B. 47 chromosomes C. 69 chromosomes D. 92 chromosomes E. 23 chromosomes 17. Which statements are correct? A. Viruses contain DNA and RNA. B. The DNA of bacteria is…
If the characteristic in the pedigree is autosomal dominant rare; and subject to complete penetrance; what is the probability the next child of individuals Il-1 and Il-2 will be affected? 8 5 8 1/4 1/2 3/4 1/8
Cambrian Jurassic Carboniferous Hadean period? illustrated by the diverse fossil record.
Explain the mechanisms of pathogenesis of this organism: (How does this organism cause disease?). (4)
What must be the output flow value of an AaBbCcDc genotype if each locus exhibits allele interactions as in situation 17?
Why is it advantageous that checkpoints evolved during the cell cycle? Refer to the figure on the right: Determine the phase of cell A. Determine the phase of cell B. Which of the cells will be haploid at the completion of the division? Explain your answer.
3) 3 pts. Approximately where along the x-axis would SNP "T" be located? A) Position A B) Position B C) Position C D) Can't be determined from information given. 4) 3 pts. Approximately where along the y-axis would SNP "T" be located? A) Position A B) Position B C) Position C D) It could be at…
According to the model, glucose undergoes the following changes during cellular respiration: each step produces NADH or FADH_. Is glucose being oxidized or reduced during cellular respiration? Explain your reasoning. Glucose -> Pyruvate -> acetyl-CoA -> carbon dioxide. Historically, the term…
If the trait in the pedigree below is autosomal recessive and subject to complete penetrance, what is the probability that the next child of individuals Il-1 and Il-2 will be affected? 5 8 1/4 1/3 1/2 3/4
Results Metformin use in the study population and risk of congenital anomaly associated with disease indications We recorded 53,689 babies affected by congenital anomaly in the EUROmediCAT database (2006-13), out of 892,482 births surveyed, across the registries that were eligible to take…
3 tanewe" 6 8 1 that it contains With 1 half life digitacy to the 250 years: right of the decimal. What percentage point; odchact eadojos! the be 96 sign ] lele Jaie H
Zone of inhibition Chlorine O-phenylphenol Hexachlorophene Quat Staphylococcus aureus (gram-positive) Escherichia coli (gram-negative) Pseudomonas aeruginosa (gram-negative)
The respiration rate of a mouse is found to be 0.058 mL O2/g-min. If this mouse weighs 29.8 grams, what volume of oxygen will this mouse consume in 0.75 hours?
Organic acids such as potassium sorbate, sodium benzoate and calcium propionate are added to many of our foods? They are interfering with the growth of many molds and some bacteria by (p. 191-192, ed. 12; p.194-5, ed. 13).
Hydrogen peroxide, peracetic acid (PA), and ozone share a mechanism of action (p. 194, ed: 12; p. 196-7, ed. 13). What is the mechanism of action of hydrogen peroxide, PA, and related compounds? Hydrogen peroxide is considered not to be a good antiseptic. What enzyme do humans produce that…
Q4) Via the action of the ribosome, what type of bond is created as one amino acid is linked to another? This bond creation is happening in what step of translation? This linking of amino acids together in a particular sequence is generating what level of protein structure before chaperonins…
What is alcohol's mode of activity? This would include ethanol and isopropanol (p. 189-90, ed: 12; p. 192, ed. 13). To help you, consider: What does ethanol do more efficiently when used at 70% concentration as opposed to 100% concentration? When skin is swabbed, how does ethanol work here?…
Choose the option below that contains the correct complementary DNA sequence to the following: 5' - AAGTCATTGCCGTA -3' 5' - UUCAGUAACGGCAU - 3' 5' - TTCAGTAACGGCAT - 3' 3' - UUCAGUAACGGCAU - 5' 3' - TTCAGTAACGGCAT - 5'
Data Table 2. Gram Staining Results Slide Photograph Microscopic Image Observations S. cerevisiae Gram negative bacilli, in red Body sample Gram positive cocci in purple arranged in grape-like clusters. Questions A) Describe the difference between Gram-negative and Gram-positive bacteria. Which…
Label the structures in the image, which shows translation.
Place the events of protein synthesis into the correct order on the right: First DNA RNA polymerase uses DNA template strand to create complementary strand of mRNA TRANSCRIPTION mRNA leaves the nucleus Nucleus TRANSLATION RNA molecules transport amino acids to ribosome Ribosome Polypeptides…
Which of these hypotheses is falsifiable? There is intelligent life on other planets. The Moon is made entirely of cheese. Isaac Newton was the greatest scientist. There is beauty in art. There is cheese on the Moon. Bethany wanted to know if cookies baked with gluten-free flour and rice flour…
The biological species concept focuses on the ability of organisms to exchange genes. True False
TABLE 4 (CONI) Unilateral Platelet Count Glutathione Ordane Stretch Bedrest Glutamine On90 Treatment Duration Calculation Accuracy Acetaminophen Escherichia coli Negative Negative Dose Negative Negative Facultative Negative Peg/Negative …
What factors influence the levels of sex hormones, including testosterone, in men and women? Select one: a. Sexual activity b. All of the above c. Intimate social interactions, such as cuddling d. The hypothalamic-pituitary-gonadal axis
Which of the following is false regarding PCOS? Select one: a. PCOS usually occurs in women with high androgen levels b. Women with PCOS can suffer from dysmenorrhea c. PCOS is a common cause of ovarian cancers d. Ovulation may not occur in women with PCOS e. PCOS is the most common cause of…
Imagine that you transfer 10 actively growing bacteria to a fresh agar plate. Two and a half hours later, you look at them through a microscope and there are now 320 bacteria. What is the generation time of these bacteria? 30 minutes 16 minutes 160 minutes 10 minutes 60 minutes 37.5 minutes
The theory of evolution: persons with their contributions to the development. Match each: James Hutton [Chose transmutation of species developed gradual theory mistakenly claimed it would not result in speciation for natural selection. Described uniformitarianism. Encoded animals provided…
The bacteria in the Gram stain depicted above would most accurately be classified as: staphylococci streptococci sarcinae diplococci single cocci diplobacilli tetrads staphylobacilli
Which of the following can cause hypoactive sexual desire disorder? Select one: a. A decrease in factors that make sex desirable. b. An increase in factors that make sex undesirable. c. Two of the above d. A, B and C all contribute to hypoactive sexual desire disorder. e. A lack of interest in…
Helicobacter pylori is a Gram-negative spirillum that can grow in the human stomach. It can cause stomach ulcers and, in severe untreated cases, even cancer. Select all of the correct possible classifications for H.…
Imagine that you transfer 10 actively growing bacteria to a fresh agar plate. Two and a half hours later you look at them through a microscope and there are now 320 bacteria. What is the generation time of these bacteria? 30 minutes. 16 minutes 160 minutes 10 minutes 60 minutes 37.5 minutes
In northern Europe, a species of daffodils in Hardy-Weinberg equilibrium (generation 0) suddenly begins selfing: What would be the genotype frequencies in the third generation of selfing if the initial allele frequencies were: A-0.5, a=0.5?
The population of deer is divided by a road. When the road has no traffic, some deer cross it and migrate from the population south of the highway to the population north of the highway. In 2013, the individuals who successfully migrated were 40, joining a population of 160 northern deer. The…
1. What is the best birth control for you? For this prompt explain what type of birth control you would choose if you needed a method of birth control: Why would this be the best method for you? What would you take into consideration before choosing this method? Are there any side effects or…
If you wanted to find an encdlomucin resistant coli, what would you do next? First, isolate a colony of bacteria from the streptomycin positive plate and grow it on qucolamtdn positive plate. Then, isolate a colony of bacteria from the streptomycin positive plate and grow it on Ted DMicin neoa…
IS a Bedlam common question. The red plug. Mia (+ or -)? Once you turn on the power supply, how do you know the current is running? Step 5. Stain gel and analyze results. What is the chemical used to stain the DNA in the gel? How does this stain work? Is this stain harmful to your DNA? Should…
How many net total ATPs are produced from complete oxidation (meaning 8 oxidation citric acid cycle and OXPHOS) of the 17-carbon unsaturated fatty acid below? Show your work: how many acetyl-CoA units are made, ATPs consumed/produced, NADH and FADH2 molecules produced in the process.
A DNA chain is a sequence of chemicals called bases. There are four possible bases: thymine (T), cytosine (C), adenine (A), and guanine (G). a. How many 10-element DNA chains are possible? b. What fraction of these chains have exactly thymine and cytosine each occurring exactly twice.
clpl DH H oH bH 4 'Cy QQ ~u tpoocchar de vaina Hq peles uaed U Fa 4.45 @ nd Wth doeluatiioos (Methodl WD d= Cuesed Uh clcuo) ,
4. Google "armadillo recipes." How is armadillo prepared and eaten? Could undercooked armadillo play a role in foodborne transmission of M. leprae? Explain.
Monocercomonoides are genus single-celled organisms that live as parasites in the guts of small animals. They lack mitochondria, but other evidence shows them to be most closely related to the excavates. Looking at the tree for eukaryotes, what can you conclude about Monocercomonoides? Choose…
Eukaryotes Chordates Reptiles and Birds, Mammals Ecdysozoa Opisthokonts Deuterostomes Match each of the options above to the items below. Notochord Endoskeleton Nucleus + mitochondria Single flagellum Amniotic egg Ecdysis
In northern Europe, species of daffodils in Hardy-Weinberg begin selfing. What would be the equilibrium (generation 0) suddenly initial allele genotype frequencies in the third generation of selfing if the frequencies were: A-0.5, a-0.5? What is the effective population size of a population of…
clpl DH H oH bH 4 'Cy QQ ~u tpoocchar de vaina Hq peles uaed U Fa 4.45 @ nd Wth doeluatiioos (Mctlodl WD d= Cuesed Uh clcuo) ,
The bacteria was susceptible to streptomycin: The bacteria does not need streptomycin to grow:
Rice plants will start to flower when daylight duration shortens. However, flowering is delayed in hd1null mutant rice even under short days. This evidence is a test for none of these requirements: sufficiency or correlation.
Which of the following statements is true about the bacterial DNA represented at arrows "A" and "B" in this image? The DNA at B is not essential for the cell to grow and function. The DNA at B is the cell's nucleus. The DNA at B may contain genes that make the bacteria resistant to penicillin.…
A scientist conducted an experiment to investigate the effect of fertilizer on plant growth rate. Plants A, B, and C were watered every day with pure water, water containing 10mg of fertilizer, and water containing 20mg of fertilizer, respectively. In this experiment, the independent variable…
2 3 5 9 4
Question 23 The ciliated slipper-shaped protozoa that you have learned about in the handout, class, etc. is ____ and it carries out sexual reproduction where its genetic material is exchanged between two of these protozoa via the process ____: a. euglena ; transformation b. paramecium ;…
Jata practical alternative assignment: Acid phosphatase activity with increasing concentrations. Acid phosphatase assay uninhibited. Nitrophenol absorbance at 405nm. Sample blanks. Concentrations (mM): 352 409 055 508 568 557 Acid phosphatase assay in the presence of unknown…
Question 11 Supposing Alexis (son of Nikolas who had Alix) lived and married a normal woman, what are the chances that his daughter would be hemophiliac? What are the chances that his sons would be hemophiliacs? 50% for both daughters and sons 50% for females; 0% for sons 0% for both daughters…
Using the "Choose Your Foods Booklet," determine the number of calories in the following meal: 4 ounces of corned beef, 1 cup of peas, 8 ounces of baked potato, and 6 ounces of apple juice. (Only enter numbers. Your answer should not contain any words.)
According to The State of Obesity 2018, which statement is false about obesity rates? Women had lower rates in 2015-2016 than men. Colorado has the lowest obesity rates in the country. There are indications that rates of obesity and severe obesity have declined from 2010 to 2014 among 2 to…
Give the name of the green algal group that contains the closest relative of plants. Then, list three derived traits that plants have that this group does not have.
Fixed Greylag Retiler 1 Kinesis action Group action movement will continue. Geese will behavior pattern retrieve 2 42483, 3843 was displaced removed H thaero into rolling movement: the nest with its beak. The beak.
Disappearance of M gene: true deuteranopia. Mutated M gene 'shifting its absorbance towards the photoreceptor: deuteranopia due to anomalous trichromacy (deuteranomaly). Below you can observe how individuals affected by these mutations would see colors: 9296 2.7% 0.66% 0.5996 0.5696 Normal…
Ecological Economics is the study of reorganizing markets to promote long-term ecological health, production, and consumption activities of humans in ways which principles of stability and sustainability of natural systems upon which we depend are included within this framework. Which of the…
Put the items in the correct order from the strongest bonds strength to the weakest: ionic bonds single covalent bonds hydrogen bonds van der Waal interactions double covalent bonds triple covalent bonds
What is the selective pressure applied during the mechanism associated with the development of drug resistance by viruses? a. The virus b. The immune system c. The drug d. A and B e. B and C
(Gift) The genus Homo first appeared in the _______ epoch, while the species Homo sapiens first appeared in the _______ epoch. ? Paleocene, Pliocene ? Pliocene, Pleistocene ? Eocene, Miocene ? Miocene, Holocene
Dated at 23 mya Africa; the earliest fossil hominoid (ape) known thus far is: Proconsul Carpolestes Aegyptopithecus Sivapithecus Actcobus
Plant Width Percentage of Vegetable Cell Nucleus # In the image of the of the along with the count, the plant that; the magnification: the regardless ruler right EZ and 8 rh Determine on the of how the width field the Wi of stained determine 3 E; 3 plant 1.5
The summary formula for photosynthesis is: CO2 + 6 H2O = C6H12O6 + 6 O2. Which side of the chemical reaction (reactants or products) has the most entropy? Which molecule has the most potential energy? Is this reaction endothermic or exothermic? Spontaneous or nonspontaneous?
Lowest table magnification: power of magnification HL Lens Information about the 041 ocular Magnification 2 objective the Total lenses compound Magnification on microscope microscopes.
Epithelial cells in the kidney reabsorb glucose from urine and return it to the bloodstream in a manner very similar to what happens in the intestine during absorption of food nutrients. It is known that the reabsorption of glucose into the epithelial cell from the urine is dependent on sodium…
An mRNA has the sequence 5' GCCACCAUGGGGGGAAGGUGAAGACC 3'. (3 pts.) Write the sequence of template and nontemplate strands of the gene encoding this mRNA. Clearly indicate which is which and include 5' and 3' polarity. Change the font (where it says paragraph above) to "preformatted" to get a…
You want to measure the blood oxygen level in a drop of blood using a pulse oximetry device. If you have a light source at 700nm and a path length of 1mm, what must be the concentration of oxidized hemoglobin (HbO2) in the blood so that the light intensity at the output decreases to one-tenth…
The lac operon (6 pts) What are operons and in what organisms are they found? What advantage do cells with operons gain? What potential disadvantages might be associated with operons? (8 pts) The table below depicts the expression of the lactose operon under three growth conditions. Describe…
The tetrodotoxin found in puffer fish is a toxin because it Select one: a.is a mutagen b. accelerates heart rate accelerates destruction by free radicals_ d. stops glucose metabolism_ e. blocks sodium channels_
The primary use of in vitro evolution is to Select one: a. determine the evolutionary history of gene families. b. study protein function. c. identify new diseases. d. take advantage of naturally occurring biomolecules. e. produce new molecules.
Leader 0 polymerase chain reaction (PCR) What is the purpose of performing PCR? How many times should PCR be performed? Are the primers used for single-stranded DNA or double-stranded DNA? What is the enzyme used in PCR? What is the special property that makes PCR a miracle?
The picture below shows agarose gel electrophoresis of various DNA samples. Which side is the positive end? Which DNA molecule is smaller in size, 8 or 1?
6. Predictions of the emergence and spread of antibiotic-resistant bacteria could play a role in public health intervention contexts. The conceptual framework we've outlined here can be formalized into an even more extensive computational simulation, where the equilibrium frequency of…
The genetic variation we observe between antibiotic-sensitive and antibiotic-resistant bacteria likely derives from (Select the most correct term): Natural Selection Evolution Mutation Phenotype
uring cardiac cycle valves must open and close at the proper time to allow proper blood flow: atrioventricular valves are open during atria and ventricular diastole b. atrioventricular valves close at beginning of ventricular systole semilunar valves open towards the end of ventricular…
Organ Systems Working Together Glucose Oxygen ATP Carbon Dioxide Water Circulatory System Digestive System Respiratory System
In the classification system devised by Linnaeus, the names of of plants end with the suffix while those of animals end with Select one: a. families; -idae; -aceae b. classes; -aceae; -idae c. orders; -idae; -aceae d. classes; -idae; -aceae e. families; -aceae; -idae
Why are the two pathways of blood clotting referred to as the extrinsic and intrinsic pathways? Select one or more: the intrinsic pathway refers to clotting factors present within the blood, while the extrinsic pathway refers to clotting factors located outside of the blood.
derived trait is one that Select one: a.is found only in members of the outgroup. b. has the same function, but not the same evolutionary origin, as a trait found in another species c is the product of an evolutionary reversal: d. differs from its ancestral form e. is homologous with another…
In studies of the sensory exploitation hypothesis, which observation would most challenge the validity of the hypothesis? Select one: a. The female preference for swords had evolved after swords evolved in males. b. The female preference for swords had evolved before swords evolved in males. c.…
Which is an important application of phylogenetic analysis in fighting infectious diseases? Select one: a. Determining when a pathogen first infected the human population b. Identifying when a new form of the pathogen emerges in the human population c. Tracing the different forms of the…
Considerng that glycolysis yields much less energy compared with mitochondrial respiration, Warburg hypothesized ihat mitochondria must be dysfunctional, and this is the initiating factor cancer formation_ Based your understanding the hallmarks cancer does dysfunctional mitochondria benefit…
Part II - Diagnosis and T cells activation Baby Joe' $ doctors diagnosed his condition as severe combined immunodeficiency (SCIS) This is a rare disease that can be life-threatening; without treatment; it is usually fatal in childhood. SCIS can be caused by several genetic mutations. In Joe's…
0 0 0 Which IN of Gene Bioreactor Pathogen 2 the the therapy above resistance following 2 0 trait engineered Into crops 7
Activity 12. Tubulinids View prepared slide of Amoeba proteus. Label the following structures: nucleus, pseudopodia, endoplasm, ectoplasm, cell membrane, food vacuole. Activity 13. Entamoeba View prepared slide of Entamoeba histolytica depicting cyst and slide depicting trophozoite. Designate…
Assume that a polygenic character in Drosophila is produced through the activity of five genes, each with two alleles. Two individuals who are both heterozygous for all five genes are crossed. How many different genotypes are expected in the offspring? 729
Valine Glycine Leucine Leucine Histidine Arginine Threonine GGA GUG UGU CGA ACA CAC CUU CCG GGA CCU CUC CCG AU AU }x
Ecosystems are the interactions of organisms with one another and with their environment. Fill in the levels of organization (from largest to smallest) and describe each. How is a population different from a community? Name at least biotic and abiotic factors in the ecosystem (refer to…
pathogen B cell helper T cell nucleus white blood cell
Dandelion seeds get dispersed by the wind and can grow almost anywhere What type of population distribution would yU expect to see for dandelions? Clumped Random Uniform
Moray eels will open their mouths and allow special shrimp to come in and the parasites living eat in their mouth_ The shrimp enter for their meal confident that the cel will not eat them Why wont the eel cat the shrimp] b: What type of symbiotic relationship is this? Align
Question 12 example Turbomans PREVENT. SLOWDOWN evolution; For the [00/305, press ALT-FidiPoo = ALT-En+Fio (Mac) Pamgna (1201) Path: D QUESTION 13 Female birds and frogs can recognize [ @ calls of specific males (males Gdcd Uns can example or: beloma SpedeflandInus & old Frondidng Pre-zygotic…
QUESTION 3 What can be said about speciation? It is process_ It is instantaneous: It cannot be reverted. Two options given here are correct:
3. Explain how interspecific competition can drive evolution
In eudicots, the growth of axillary buds is inhibited by auxin produced in the apical meristem b the shade created by the adjoining leaf auxin produced in the adjoining leaf blade_ excess cytokinins produced in the root none of the above
According to "The Trees that Miss the Mammoths," the seeds of this common NYC street tree may once have been dispersed by Pleistocene megafauna: Gleditsia triacanthos, Quercus palustris, Ulmus americana, Ginkgo biloba, Platanus acerifolia.
In human adults, as part of physiological processes such as wound healing and female reproductive cycling, angiogenesis is turned on. What do you think is the fundamental difference between angiogenesis turned on during the normal physiological process and during cancer progression? (3 points)
Gnastic movements are oriented towards a stimulus. They can occur without any kind of stimulus, involve growth, are reversible and repeatable, or do none of the above.
In Farmer & Ryan (1990), the stressed plant produces methyl jasmonate, and then neighboring plants produce proteinase inhibitors, glandular trichomes, toxic alkaloids, and lipid-rich rewards for ants. None of the above.
Chemicals that ' reduce plant digestibility include cellulose_ Oa lignin. tannins silica. all of the above
The mycorrhizal networks that link trees in forests are thought to be important for forest health. According to Beyler et al. (2009), network analysis has hypothesized that these networks influence seedling establishment, drought resistance, pathogen resistance, and tree mortality.
DNA is anti-parallel, which means purines bind to pyrimidines. Bases are held together by phosphodiester bonds. There is a sugar-phosphate backbone. One strand runs 5' to 3', and the other strand in the opposite direction.
In woody plants, unusually narrow annual growth increments indicate that a tree was attacked by the woolly adelgid. Additionally, periods of adverse conditions, including prolonged drought, are only created right before a tree dies. These increments are formed when saplings are released from…
The idea that plants are able to "hear" is controversial; but one study suggests that when evening primrose detects vibrations from visiting pollinators, the plants demonstrate a nastic response and turn the petals to face the pollinator. They also increase sugar concentration in the nectar,…
Potential benefits of frugivory include a. the seed coat is scarified. b. germination inhibitors in the fruit pulp are removed. c. "fertilizer" is deposited with the seeds. d. all of the above. e. none of the above.
(ii) State the diameter of the pore labelled X [1]
Which of the following is NOT a terpenoid? a. rubber b. saponin c. vanillin d. essential oil e. none of the above; all are terpenoids
Researchers at SUNY College of Environmental Science and Forestry are engineering a blight-resistant American chestnut tree by introducing a gene for bacterial resistance. There are dozens of genes involved in resistance in the Chinese chestnut, including a wheat gene that breaks down the…
One herbivore feeding strategy that is likely to create a strong negative selective pressure on a plant is granivory. Other feeding strategies include gallmaking, nectarivory, frugivory, and detritivory.
Plants acquire information about the time of year by detecting a. the position of the stars. b. changes in wind intensity and direction. c. the length of the night. d. all of the above. e. none of the above.
According to Beyler et al.'s (2009) network analysis of Douglas fir trees and mycorrhizal fungi, large mature trees a. were colonized by just one or two fungal genets. b. were frequently linked to other trees, including less mature trees. c. were considered hubs because they monopolized…
Outline the various processes of altered cellular growth including hypertrophy; hyperplasia, dysplasia; in situ cancer and invasive cancer: Compare and contrast the similarities and differences biological behaviours between malignant and benign tumors.
From the information given above, her nasal secretion reduced and became clear after taking Augmentin plus Tamiflu: Explain why the nasal secretion was cleared initially:
Which of the following plant compounds is NOT an alkaloid? morphine b. cocaine theobromine quinine none of the above; all are alkaloids
A nocturnal, tubular white flower with a sweet aroma is probably pollinated by carrion or dung flies, long-tongued bees, moths, or flies that mimic bees.
Question 548380 1 H 0 | 1
Asexual reproduction can be disadvantageous because a. all progeny may be negatively affected by minor changes in the habitat. b. some progeny may be able to colonize sites that are not suitable for the parents. c. some progeny may be better adapted to local conditions than the parents. d.…
Seed plants promote out-crossing with spatial separation of pollen and ovules: temporal separation of pollen and ovule maturation_ chemical barriers to pollen germination chemical barriers to pollen tube growth: any of the above.
In many trees, the heartwood is impregnated with phenolic compounds b resists fungal infection: conducts most of the water and minerals. stores carbohydrates does both a and b_
Tomatoes, bananas, red peppers, and blueberries are all examples of a. drupes. b. follicles. c. berries. d. samaras. e. none of the above.
The sign attached to the London Plane tree outside the Marshak building is no longer visible because it has been covered by inner bark and outer bark.
Water-dispersed fruits only germinate near fresh water bodies. They often have geographically widespread distributions and are carried by oceanic water currents. The correct answer is both b and c.
dominant, recessive, way to identify whether an organism is heterozygous or homozygous, organism that is homozygous, phenotype.
Which of the following is FALSE: Acquiring prophage may cause recipient bacteria to make toxins or express genes in the prophage that do not specify viral structural proteins. Prophage is viral DNA inserted into the bacterial chromosome. Prophage may leave the bacterial chromosome. When…
Text: # (10 Subunits 28 1 Alatcordse rdhe ez 1 only ' L be used enzymelproteinlribozyme Telomerase once 8 83 # some words role Ligase the 5= central Riboseme dogused Prerasee "Ile Ie molecular 8 G5e differentiation they pts) DNA involved Pol of function? and wiq # differ? 4loq 1 "specitic #…
Questions What is the arthropod exoskeleton composed of? What characteristics indicate that horseshoe crabs are more closely related to arachnids like spiders than TO Other crabs? Give the stages and an example of complete metamorphosis Give the stages and an example of incomplete…
Consider what the following mutations would do to the catalytic mechanism of chymotrypsin. The specificity pocket remains hydrophobic but becomes more shallow. The aspartic acid in the active site mutated to asparagine. The serine in the active site mutated to cysteine.
13. [5 points] What units are EMG measured in? Explain how these units relate to the physiology of muscle contraction. How does EMG collect this data?
The roan coat colour in shorthorn cattle is the result of codominance of the coat colour alleles. A roan shorthorn mated with a white shorthorn. What is the probability that the offspring will be white shorthorn? Record the answer as a value between 0 and 1, with two significant digits:
Q 6. Based on your test results for the two parents, what ABO blood types are possible among their biological children, and what is the probability of occurrence of each? [1 sentence] Q 7. Based on your answer to Q6, comment on the possible family background of each of the two children, and…
Genetics discussion Work sheet 2 Name: ID: In tomatoes, pear shape, yellow color; and terminal flower position are recessive traits produced by alleles f, r; and t, respectively: The dominant phenotypes for each trait full shape, red color; and axial flower position- are the product of…
7. Consider the problem of comb shape inheritance in chickens, where walnut, rose, pea, and single are observed as distinct phenotypes. How is comb shape inherited, and what are the genotypes of the P1 generation of each cross? Use the following data to answer these questions. Test the results…
37. Which of the following rows correctly identifies the relationship between the blood type alleles IA, IB, and i? A. Relationship between IA and IB: Dominant and recessive; Relationship between IB and i: Multiple alleles B. Relationship between IA and IB: Codominance; Relationship between IB…
If a planet X has a tilt of 18 degrees on its axis, then:
Complete the following table by: (1) matching the appropriate sketch for the phase from the list below the table (note that yellow indicates "lit" while black indicates "dark"); (2) selecting the correct Moonrise/Moonset pairing for each phase (where Moonrise appears first followed by Moonset);…
Andalusian chickens have black and white plumage. They display incomplete dominance in feather colour: blue birds are heterozygous. The white Andalusian rooster mates with a black Andalusian hen. What percentage of the offspring are expected to be blue Andalusians? A. 50% B. 0% C. 100% D. 25%
The physical splitting of a eukaryotic cell is called: duplication binary fission cytokinesis telophase NKOLHRANGHAUHERUHAUSAMAL est checked 3
4. Label the organ of the digestive track on the following diagram noting the major function of each organ.
3. Choose an organ within the digestive track of vertebrates. For this organ you will need to describe what the organ does, any other organs that may be associated with the organ. What happens to your organ when it stops working Or not working properly, and three interesting facts about your…
SIZE (bp) 000 900 800 700 600 500 400 300 200 100 Figure J: Gel electrophoresis image of restriction enzyme [indlll and EcoRI digestion of DNA from varying E. coli transformants. Lane containing 100 bp DNA Ladder. Lane containing uncut Blue colony plasmid. Lane containing Blue colony plasmid…
If you have crackers at home, preferably saltines: 1. Take a small bite of the cracker; holding it in your mouth without chewing or swallowing: After 2 minutes, discuss the answer questions. Why did the cracker begin to get soft in your mouth? What did you taste? After a few minutes did the…
The above procedures are carried out to identify the type of cell respiration in the yeast and interpret the results on yeast reaction by using methylene as the artificial hydrogen acceptor. Answer the following essay questions: 1) Explain in detail the general type of cell respiration in the…
445 PM Wed May 20 100% 5:27:28 Exit You will only look at standing diversity and that way you will not have to do those pesky breeding experiments. Your data end up looking like this: 12 10 8 6 4 2 0 AABB AABb AAbb AaBB AaBb Aabb aaBB aaBb aabb …
The present problems of coolant in machining are the contamination and stains on the workpiece due to the utilization of the cutting fluid. You are currently working in a biomedical engineering company and required to design the machining process for a medical implant, such as a ball joint used…
Look at your food label again to answer the following questions: List the main ingredients in your food item by its type Carbohydrates: Proteins: Lipids: Identify any trans fats in the Ingredients list. Identify any added sugars in the Ingredients list. 10. What surprised you most about the…
The diagram above depicts the Law of Segregation, complete dominance, crossing over, and nondisjunction.
A. An angiosperm plant has specific mechanisms to prevent self-pollination. Define the process and its types. How do you cross two distant plant species? Explain with suitable methods. What are the screening techniques you know to analyze them in different stages of development? (2+5+3-10…
Rainfall log(N) Year Questions During which time interval years does the survival of each cohort of G. Laeeca have the steepest slope on the graph? Where is the slope of the line highest? Can the environmental factor of rainfall influence survival in occurrence and/or number? Explain. Consider…
social consequences of doing science: Pretend you are a member of an international bioethics committee determining rules on gene therapy: The committee is trying to decide whether fatal genetic diseases with no current cure like Huntington'$ disease should be allowed to be removed from the…
Which of the following results in genetically diverse cells? No answer text provided_ WM No answer text provided Meiosis Mitosis
Question 1 When do fossils resembling modern Homo sapiens appear in the fossil record in Africa? (approximately) 160,000 ya 60,000 ya 600,000 ya 1.6 mya Question 2 Anatomically modern humans have a vertical forehead a prognathic face enlarged canines a prominent brow ridge
When Mendel crossed purple-flowered pea plants, he never got offspring with flowers that had an intermediate color.
1 2 3 Do 4 5 Ooc
Annelids are the most simple organisms that have a body cavity What is the purpose of body cavities in animals who have them? (Circle one or all that apply) Provides space for organs to grow Allows organs to be independent from the outer body wall Provides the ability for organs to evolve…
CGQTIAH T 1975 cohort of John Lennon/DZR calculate The much Successful leadership Earth; Unusually To visualize that the Eradic - data JTE survivoship Human Hahle the right = Canac c stickers (found ~survivorship the 1975 cohort hundredths place - CIAIC Tbk the grid below Glic= sndcrs. Make…
Two-photon microscopy uses long-wavelength light, and therefore two photons instead of one are needed to excite the fluorochrome to emit light. The differential stains most frequently used for bacteria are crystal violet and methylene blue.
Match the definitions with the terms (not all terms will be used; yes you can use your notes). Allele that is seen even if present with the recessive form: Dominant Another word for egg and sperm cells: Gametes Units of hereditary information (codes for one protein): Genes Two identical…
According to the cell wall components, there is differences between Gram positive and Gram negative bacteria_ 8- Penicillin inhibits peptide bridges in peptidoglycan in the cell wall of bacteria_ 9-
Grm Positive Gnm Negative RoDS CoccE aaoTHOHMac Oma MEOATIE POSITIVE
Question 10 Match the reagent with it's function. Provides a source of nitrogen for the cells for cell growth, but it is unstable, particularly at 37 °C To control bacterial contamination in the cell culture Provides a source of carbon and vitamins for the cells and is stable at 4 °C Stains…
44. Proteins (the amino acids) contain all the following elements EXCEPT a. Carbon b. Nitrogen c. Phosphorus d. Hydrogen e. Sulfur
QUESTION 25 EXERCISE 5; DNA EXTRACTION 25, 26,27. Question 25. The cell wall of a strawberry cell (or a plant cell) is made of the following: Oa Lipids Ob. Albumin Cellulose d. Starch QUESTION 26 26. How many barriers (number) need to be broken to ease the DNA from inside of strawberry cells
Table 5. Frequencies of alleles (bins) for hyper-variable VNTR loci in Caucasians VNTR Locus DIS7 Binned Allele 605 372 802 563 601 Frequency 0.004 0.006 0.009 0.012 0.011 VNTR Locus D2S44 Allele 0.007 0.009 0.014 0.007 0.016 Frequency 0.020 0.011 0.014 0.010 0.029 …
Question 3: According to what you have learned, compare the process of RNA transcription from DNA between eukaryotes and prokaryotes. points) Question 4: Explain brielly: some antibiotics are designed to target protein synthesis in bacteria without harming protein synthesis in human cells. (2…
The figure below shows a slide of duodenum. The arrow labelled 'A' is pointing to which type of tissue? Select one: a. Muscle tissue b. Nerve tissue c. Epithelial tissue d. Connective tissue
QUESTION 36 36. Cellulose is a ______ whereas enzymes are ____ QUESTION 37 37. Nucleic acids in cells serve the purpose of
The error rate (wrong base pairing) during DNA replication is controlled by ? A.) DNA polymerase III proofreading B.) 3' -> 5' activity of DNA polymerase III C.) the effectiveness of primase D.) effectiveness as ligase
27. Identify the barriers in the right order (outside to inside). a. Cell membrane, cell wall, nuclear membrane b. Nuclear membrane, cell membrane, cell wall c. Cell wall, cell membrane, nuclear membrane d. Cell membrane is the only barrier to be broken to release the DNA. Which of the…
QUESTION 32 32. Starch a. Present in animal muscles b. Monomer unit of proteins. Storage form of energy molecules (glucose) in plants. d. Table sugar. e. Monosaccharide. QUESTION 33 33. Amino acid a. Present in animal muscles. b. Monomer unit of proteins. Storage form of energy molecules…
EXERCISE 5: DNA EXTRACTION 25,26,27. Question 25. The cell wall of a strawberry cell (or plant cell) is made of the following: 0 a Lipids 0 b. Albumin Cellulose Starch QUESTION 26 26. How many barriers (number) need t0 be broken to release the DNA from inside of strawberry cells c.3 d.4
According to the scheme above, a mutation results in a defective enzyme A. Which of the following would be a consequence of that mutation? Explain your answer. a - an accumulation of A and no production of B and C b - an accumulation of A and B and no production of C c - an accumulation of B…
Illustrate the basic structure of an antibody and highlight the Fab and paratope. (10 marks) 2. Corrected_text: A testing lab recently developed a new kit for rapid detection of chloramphenicol in milk. The rapid testing kit contained the following: - Strip with sample window and test window -…
Text: Question Completion Status FIGURE 2 for Q 18, 19, 20, 21 18. A in FIGURE represents the process of Translation; protein that allows the construction of Transcription; protein c Translation RNA (messenger RNA) Transcription; RNA (messenger RNA)
Disaccharides such as lactose and maltose have unique metabolic pathways to oxidize their carbons completely to carbon dioxide, and these pathways are independent and do not involve the impact of glycolysis. True False The carbons of acetate that enter the citric acid cycle are expelled…
21. Surprisingly, the human genome contains fewer genes than expected. How, then, is the human genome more complex than that of other organisms? A) Post-translational processing adds diversity to the resulting polypeptides. B) RNA transcripts of human genes are more likely to experience…
An RNA molecule has the sequence 5'GcahUGcAAJZ. What is the sequence of the gene in the DNA? A) 5'Gcaatgcaa-3' B) 5'(GttcacottaX C) 5'-66ttacgtt-3' D) 6-TTGcattgc-3
11. Mitochondria a. Uses glucose to generate cellular energy b. An internal vesicle with digestive enzymes c. Ribosomes d. Uses solar energy to generate glucose e. Packaging center of the cell 12. Chloroplasts a. Uses glucose to generate cellular energy b. An internal vesicle with digestive…
How many molecules of ATP can eukaryote make from complete oxidation of one molecule of glucose?
What representative bacterial Genus is endospore forming, Gram positive, obligate anaerobe? Clostridium Mycoplasma Mycobacterium Pseudomonas Bacillus
QUESTION 8 Cells of the testis which constantly makes testosterone (a STEROID hormone) is rich in Smooth ER 0 b. Rough ER
Which culture produces the most lactic acid? coli growing glucose broth at 35°C with O2 for days coli growing glucose broth at 35°C with O2 for days AND coli growing glucose broth at 35°C without O2 for days None of the choices are correct coli growing in glucose broth at 35°C with O2 for…
The 5'-carbon of DNA refers to where a nitrogen-containing base attaches, the position on the sugar component of a nucleotide, the phosphate group, where methionine attaches, and the start of where complementary pairing begins.
Generally, antibodies recognize and interact with specific regions on antigens called PAMPs active sites haptens all of the choices are correct epitopes
Snoath V constantly makes 1 b. False M 1 have 1 1 PROTEIN hormone] 1 ; specific functions structured inside eurynCric membrane (answer LUES and 8}: 1 Wnicn
1
...
4
5
6
7
8
...
43