(122) WhatsApp Cna:GPT Exam 52 (page 4 of 5 ) etrik.edukaticom Tricket - Googlen Jitsi Meet Imported From IE Imported From IE (1) Situs LMS ini dibuat di Edukaticom melalui paket free 12 bulan. Silakan upgrade layanan untuk menghilar dukati arning in seconds Time left 0:55:27 Please match the type of DOE and their objective! Screening Design Response surface method Factorial Design Mixture Design Taguchi Design Optimizing the setting to get optimum response choose.. Identifying \( \mathrm{S} / \mathrm{N} \) ratio and choose the setting with less variation Optimizing the setting to get optimum response' Identifying the important factors from suspected factors Understanding the interaction between factors Optimizing recipe from several ingredients Choose. Next page
Added by Tammy W.
Close
Step 1
DOE is a structured, organized method for determining the relationship between factors affecting a process and the output of that process. Here are the types mentioned and their general objectives: - **Screening Design**: Used to identify the most important Show more…
Show all steps
Your feedback will help us improve your experience
Lottie Adams and 58 other Principles of Accounting educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Recommended Videos
20. You run the original Sanger method of DNA sequencing on a strand of DNA (below) using radioactively-labeled dideoxynucleoside triphosphates (ddNTPs). Each of your four reactions contains a small quantity of one dideoxynucleotide (ddATP, ddCTP, ddGTP, or ddTTP). The reactions are subsequently run on a gel to give you the result shown. Which lane contains the reaction with ddGTP? A. Lane 1 B. Lane 2 C. Lane 3 D. Lane 4 E. None of the above 5' - Primer - 3' 3' - TCGGTCAATCCAGGCGATAT - 5' The next two questions concern the SDS-PAGE figure below. Lane 1 contains an unknown sample. Lane M contains a mixture of the following proteins (listed alphabetically with the associated molecular mass). Protein | Molecular Mass Bovine carbonic anhydrase | 29,000 Bovine milk aprotinin | 6,500 Bovine milk lactalbumin | 14,200 Bovine serum albumin | 66,000 Beta-galactosidase | 116,000 Chicken egg ovalbumin | 45,000 Rabbit muscle myosin | 205,000 Soybean trypsin inhibitor | 20,000 21. Which protein is circled? A. Bovine carbonic anhydrase B. Bovine serum albumin C. Chicken egg ovalbumin D. β-galactosidase E. Soybean trypsin inhibitor 22. The normal variant of the human β-chain hemoglobin gene is ~1600 base pairs in length. Which of the proteins in Lane 1 is most likely to be β-hemoglobin? [Hint: the average amino acid has a molecular mass of ~110] A. P1 B. P2 C. P3 D. P4 E. β-hemoglobin cannot possibly be present on the gel
Dennis H.
Problem 3 (25 pts) You need to construct a 2^4 full factorial experiment with four factors A, B, C, D. The two levels of each factor are denoted by — (lower level) and + (higher level). Four machines (machine is not an experimental factor) are available for the experiment, and owing to resource constraints, you cannot conduct more than four trials on each machine. There may some difference among the four machines in terms of performances. (a) What would be the block size in this experiment? (b) How many factorial effects will be confounded with the block effects? (c) Using the generators B1 = ABC and B2 = ABD, design the experiment by showing which of the 16 trials (i.e., combinations of A, B, C, D) will be conducted on machine 1, which on machine 2, etc. You need not randomize the trials. (d) Will any two-factor interaction be confounded with blocking effects? If so, which one?
Madhur L.
Sri K.
Recommended Textbooks
Horngren’s Cost Accounting
Cost Accounting A Managerial Emphasis
Principles of Accounting Volume 1: Financial Accounting
18,000,000+
Students on Numerade
Trusted by students at 8,000+ universities
Watch the video solution with this free unlock.
EMAIL
PASSWORD