Match the following components of the spliceosome with their role in the splicing out of RNA introns. a. U1 b. U2 c. U4 d. U5 e. U6 H-bonds with U6 to form the catalytic center of the spliceosome. The first to bind the 5' splice site of the intron. Inhibits catalysis by the spliceosome until it dissociates from the complex. The first to bind the branchpoint of the intron.
Added by Tracy M.
Close
Step 1
Step 1: U2 snRNA binds to the branchpoint of the intron. Show more…
Show all steps
Your feedback will help us improve your experience
Sri K and 55 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
Question 1: Which nucleotide initiates the second transesterification reaction? 5'----exon1-----NpX----intron----YpZ-----exon2----3' 1. X 2. Y 3. Z 4. N 5. free guanosine nucleotide Question 2: What do sheltering proteins do? 1. Serve as a template for replication 2. Extend telomeres 3. Remove telomeres 4. The T loop 5. All of the above
Madhur L.
The DNA molecule below is believed to contain a binding site for protein X. It is labeled at the 5' end of the top strand (*), then subjected to a footprinting experiment. In the idealized gel below, there is a band for every base of the labeled strand. On the DNA sequence, point out the binding site for protein X, and briefly explain: (5') GGATTCTAATAAAGTAACGCGTTACGACTTGG CCTAAGATTATTTCATTGCGCAATGCTGAACC Protein X
Josee P.
Arrange the following list into the correct sequence for part of the cycle of a retrovirus: 1. dsDNA integrated into host DNA 2 . viral proteins synthesized on host ribosomes $3 .$ viral DNA uses host enzymes to transcribe viral RNA 4. reverse transcriptase catalyzes synthesis of ssDNA $5 .$ synthesis of second DNA strand (a) 5,2,1,3,4 (b) 5,2,3,4,1 (c) 4,5,1,3,2 (d) 4,1,2,3,5 (e) 2,1,3,4,5
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
18,000,000+
Students on Numerade
Trusted by students at 8,000+ universities
Watch the video solution with this free unlock.
EMAIL
PASSWORD