Question

3. The base composition of an RNA virus was analyzed and found to be 14.1% A, 14.0% U, 36.2% G, and 35.7% C. a) Would you conclude that the viral genetic material is single stranded RNA or double stranded RNA? b) Calculate the A, C, G, and T content for the following molecule which is part of a gene from a plant chloroplast. Just one of the two strands is shown. 5'-tcattcatgattggccaaatcattgatacaaataatatccaaataccaaatccgccttctagat aaccttcgcgaaatagaagaaactcttggaaaggtcaaggaaaaaacttgttcttctt-3' c) Assume instead that the sequence was for a virus with a genome consisting of single-stranded DNA. How would this change your calculation?

          3. The base composition of an RNA virus was analyzed and found to be 14.1% A, 14.0% U, 36.2% G, and 35.7% C.
a) Would you conclude that the viral genetic material is single stranded RNA or double stranded RNA?

b) Calculate the A, C, G, and T content for the following molecule which is part of a gene from a plant chloroplast. Just one of the two strands is shown.

5'-tcattcatgattggccaaatcattgatacaaataatatccaaataccaaatccgccttctagat
aaccttcgcgaaatagaagaaactcttggaaaggtcaaggaaaaaacttgttcttctt-3'

c) Assume instead that the sequence was for a virus with a genome consisting of single-stranded DNA. How would this change your calculation?

3. The base composition of an RNA virus was analyzed and found to be 14.1% A, 14.0% U, 36.2% G, and 35.7% C.
a) Would you conclude that the viral genetic material is single stranded RNA or double stranded RNA?

b) Calculate the A, C, G, and T content for the following molecule which is part of a gene from a plant chloroplast. Just one of the two strands is shown.

5'-tcattcatgattggccaaatcattgatacaaataatatccaaataccaaatccgccttctagat
aaccttcgcgaaatagaagaaactcttggaaaggtcaaggaaaaaacttgttcttctt-3'

c) Assume instead that the sequence was for a virus with a genome consisting of single-stranded DNA. How would this change your calculation?

Added by Jerry P.

Question

Please give Ace some feedback