4.1 After a successful sub-cloning experiment, you also manage to express the protein of interest and it turns out that most of the protein is in the cytosol. Discuss how you will go about accessing and purifying the protein. Describe the cell disruption method of your choice as well as the purification method to apply and why. Please note that the protein of interest is a His Tag protein. (10
Added by Rubbia K.
Step 1
Once the cells have reached the desired density, harvest them by centrifugation. Discard the supernatant and resuspend the cell pellet in an appropriate buffer, typically a lysis buffer that may contain a protease inhibitor cocktail to prevent protein degradation Show more…
Show all steps
Your feedback will help us improve your experience
Mithlesh Kumari and 67 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
11. Describe the basic method of DNA cloning, including the role of the restriction enzyme (RE), ligase, alkaline phosphatase, and CaCl2. Do researchers typically use a Type 1, 2 or 3 RE when cloning DNA, and why? How would using one of the other two types of RE's affect the cloning process? 12. Describe the characteristics of the pUC19 cloning vector, including the role of drug resistance, insertion identifiers, and allowable target fragment lengths. 13. Describe the basic differences between plasmid, phage, YAC, and BAC cloning vectors. How are the basic mechanisms of phage cloning similar and different from plasmid cloning? 14. Describe the process of generating a cDNA clone. What are some of the limits of cDNA cloning?
Sri K.
You want to clone the following gene into the pBR322 vector. Explain how you will perform the cloning. How will you select for bacteria that is carrying the plasmid? (Remember if you insert within a gene in the plasmid it will be disrupted.) CGTGGATCCAGAATTCTATATACTAGCTAAGATG GCCGGATCCGCTTTGGGAAGAATTCGGATCC GCACCTAGGTCTTAAGATATATGATCGATTCTAC GGGCCTAGGCGAAACCCTTCTTAAGCCTAGG Role of Restriction Enzyme sites 2. The gene from question 1 is found to be mutated in a genetic disorder. The mutation is highlighted below in yellow. (The normal sequence is above.) CGTGGATCCAGAATTCTATATACTAGCTAAGATG GCCGGATTCGCTTTGGGAAGAATTCGGATCC GCACCTAGGTCTTAAGATATATGATCGATTCTAC GGGCCTAAGCGAAACCCTTCTTAAGCCTAGG Explain how this mutation could potentially be corrected using a technique described in this module.
You want to clone the gene Dlk1 into a plasmid that will be used to generate a transgenic mouse. "MCK prom" denotes a promoter from a gene expressed exclusively in muscle. KanR is Kanamycin resistance gene, which acts as a selectable marker in this plasmid. Based on the illustrations of the plasmid and the Dlk1 gene (labeled Dlk1 ORF), which restriction enzyme(s) should you use to clone Dlk1 into this plasmid? Sall Pstl Kpnl BamHI ORI MCK prom EcoRI KanR Kpnl Kpnl BamHI Sall Pstl EcoRI Kpnl ATGACT... ...TACTGA TACTGA... ...ATGACT Dlk1 ORF 1.5 kb BamHI, EcoRI BamHI, Pstl Sall, Pstl Kpnl, EcoRI Kpnl
Adi S.
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
18,000,000+
Students on Numerade
Trusted by students at 8,000+ universities
Watch the video solution with this free unlock.
EMAIL
PASSWORD