6. (4 pts) The goal of the above experiment was to clone pc2 gene for gene expression in a transgenic plant using a known pc2 gene sequence. However, now you want to clone pc3, a very similar gene with little sequence variation compared to pc2 (only a few nucleotides different in each primer, forward and reverse). You have tried to optimize your primers and your PCR conditions but are having a hard time ONLY amplifying pc3 and not other pc genes. Describe one alternative PCR strategy that can be used to address amplification issues with pc3.
Added by Christopher P.
Close
Step 1
Step 1: The question asks for an alternative PCR strategy to amplify pc3 specifically, despite its similarity to pc2. Show more…
Show all steps
Your feedback will help us improve your experience
Adi S and 88 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
You want to amplify the coding sequence for Gene X by PCR. Describe how you would go about this process, including the design of appropriate PCR primers. In your answer, discuss factors that can influence the success of your PCR and how these can be optimised in the case of sub-optimal results. Gene X: ATGGTACGTGGACTGTGACGGTACGTGGTGCA TATGCATGGCATGCCGTTGA.
Adi S.
PCR is typically used to amplify DNA that lies between two known sequences. Suppose that you want to explore DNA on both sides of a single known sequence. Devise a variation of the usual PCR protocol that would enable you to amplify entirely new genomic terrain.
Joy C.
B) The thermocycler is not only old, but is faulty, which you were not aware of. This faulty instrument did not perform any of the annellation steps. Explain the chemical consequence of this step and how would that affect the product yield? C) After figuring out that the thermocycler was faulty, you found one which works and redid the PCR. To be sure of getting enough yield, you did 3 independent PCR, using three different sets of primers. I have listed the forward primers (only) below. Considering all of these primers are complimentary to the reverse strand of d, comment which one will work the best. Why? Forward primer 1: ATCAAGTACCAGTACGA Forward primer 2: GCCCGTACGCAGCGCG ATCAAGTACCAGTACGA Forward primer 3: ATCGTTATCGAAATCGGGATCGCCAT CAAGTACCAGTACGA D) Finally, the PCR worked out and you ligated the gene of interest in the vector shown in figure (I) and transformed this plasmid into DH5Ě‘Ě‘. What antibiotic(s) would you use while growing the cells and why?
Jenny W.
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
18,000,000+
Students on Numerade
Trusted by students at 8,000+ universities
Watch the video solution with this free unlock.
EMAIL
PASSWORD