A protein molecule consists of the amino acids leucine, serine, and serine. What would be a possible sequence for this protein? (Use the genetic code) What is the sequence of mRNA molecules responsible for forming the ribosome? The ribosome receives the following mRNA message: AAA CGA GAA, GUU. What will be the sequence of the tRNA anticodons joining the mRNA molecule?
Added by Henry N.
Step 1
First, we need to find the mRNA sequence for the given amino acid sequence: leucine, serine, serine. Using the genetic code, we can find the corresponding mRNA codons for these amino acids: - Leucine (Leu) can be coded by multiple codons: UUA, UUG, CUU, CUC, CUA, Show more…
Show all steps
Your feedback will help us improve your experience
Supreeta N and 98 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
A protein molecule consists of the sequence cytosine, leucine, tyrosine, serine, leucine. What sequence of mRNA codons would be responsible for forming this protein? CCUU UAU UCU CUU Sometimes a mistake occurs in the translation of an mRNA strand. Suppose that the reading of the mRNA strand began, by mistake, at the second nucleotide instead of the first. Write the sequence of amino acids that would be formed.
Suman K.
Given the following sequence of mRNA, what would the resulting amino acid sequence be? $$AUGAAACGGGGACCAAUGGAUAACUAA$$
Joanna Q.
If the sequence on the DNA molecule calls for a protein with the following DNA codons: 1) What would be the base sequence on mRNA? 2) What would be the base sequence on tRNA? 3) What would be the amino acid sequence of the protein being made? DNA TAC GGC CAT GTA ATA ACT mRNA tRNA amino acid sequence The statements listed below are the events in protein synthesis. Put the statements in the order in which they occur: (1 = first step - 6 = last step) The RNA is sent to the cytoplasm in the form of mRNA. mRNA attaches to a ribosome. Newly arriving amino acids are connected to the growing polypeptide by peptide bonds.
Sri K.
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
Watch the video solution with this free unlock.
EMAIL
PASSWORD