A strand of mRNA after transcription is given below. Based from the supplied sequence of mRNA codons, give the complementary tRNA anticodons and the amino acids on the polypeptide chain. mRNA codons: UAC-UUC-GCG-ACC-CAC-UGA-UAC-GAC-CCC-AUC tRNA anticodons: 1. Polypeptide chain (chronological order) 1. 2. 3. 4. 5. 6. 7. 8. 9. 10.
Added by Lu-S N.
Close
Step 1
Remember that in tRNA, Adenine (A) pairs with Uracil (U), and Cytosine (C) pairs with Guanine (G). mRNA codons: UAC-UUC-GCG-ACC-CAC-UGA-UAC-GAC-CCC-AUC tRNA anticodons: AUG-AAAG-CGC-UGG-GUG-ACU-AUG-CUG-GGG-UAU Now, let's find the corresponding amino acids for Show more…
Show all steps
Your feedback will help us improve your experience
Adi S and 73 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
mRNA: 5'- UAC GGG GUG AUG CCU CAA AUC UCG UAA UGG - 3' Question 7 of 7 Second Letter UUU Phe UCU Ser UAU Tyr UGU Cys U UUC UCC UAC UGC C UUA Leu UCA UAA Stop UGA Stop A UUG UCG UAG Stop UGG Trp G CUU Leu CCU Pro CAU His CGU Arg U CUC CCC CAC CGC C CUA CCA CAA Gln CGA A CUG CCG CAG CGG G AUU Ile ACU Thr AAU Asn AGU Ser U AUC ACC AAC AGC C AUA ACA AAA Lys AGA Arg A AUG Met ACG AAG AGG G GUU Val GCU Ala GAU Asp GGU Gly U GUC GCC GAC GGC C GUA GCA GAA Glu GGA A GUG GCG GAG GGG G Continue from question 6 above, please identify the resulting polypeptide sequence encoded from the above DNA fragment. Hint: Translation only starts from AUG start codon, and ends at STOP codon. Codons must be read in the 5' to 3' direction on mRNA. Polypeptide sequence: N' - -C'
Sri K.
Write the tRNA sequence for the given strand of mRNA (Ignore start and stop codons) 5'- AGGUCAUGCAUGGGCAUGCAU -3' Label the RNA strand below, consider how Crick and Brenner read DNA. Translate the amino acid sequence for the given mRNA strand. Remember that codons are 3 base pairs long. (DO NOT ignore start and stop codons) a. 5'- AUG CAC UGU CCU UUC GCU GAC UAA -3' b. 5'- GAG AUG AUC UGG UUG GAA UCG UGA -3'
Dave K.
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
Watch the video solution with this free unlock.
EMAIL
PASSWORD