A strand of mRNA consists of the following nucleotides: 5' AUUCUGGCUA 3' Which of the following represents the non-transcribed (sense) strand of the DNA? 5' TAAGACCGAT 3' 5' ATTCTGGCTA 3' 5' UAAGACCAU 3' 5' AUUCUGGCUA 3'
Added by Morgan R.
Close
Step 1
To find the non-transcribed (sense) strand of DNA, we need to remember the base pairing rules: A pairs with T (in DNA) and U (in RNA), and G pairs with C. Also, the mRNA sequence is complementary to the template strand of DNA, and the sense strand is Show more…
Show all steps
Your feedback will help us improve your experience
Adi S and 51 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
9. The following DNA strand is the CODING strand. What is the sequence of the RNA which is transcribed from it? 5' ATT CTC CTA GGA TTA CGC 3' a. 5' ATT CTC CTA GGA TTA CGC 3' b. 5' AUU CUC CUA GGA UUA CGC 3' c. 5' UAA GAG GAU CCU AAU GCG 3' d. 5' GCG UAA UCC UAG GAG AAU 3'
Adi S.
The DNA strand shown below is transcribed into mRNA (it is the template strand). The mRNA will then be translated into a small polypeptide. DNA Sequence: 3'GCTACCTCCGCAAATTATGCGGCATTGCATA5' The corresponding mRNA sequence would be: A. 5' CGAUGGAGGCGUUUAAUACGCCGUAACGUAU 3' B. 3' GCTACCTCCGCAAATTATGCGGCATTGCATA 5' C. 5' GCTACCTCCGCAAATTATGCGGCATTGCATA 3' D. 3' CGAUGGAGGCGUUUAAUACGCCGUAACGUAU 5' E. 5' GCUACCUCCGCAAAUUAUGCGGCAUUGCAUA 3'
Sri K.
A DNA strand with the non-coding (antisense) sequence 3' - AACGTAACG - 5' is transcribed. What is the sequence of the mRNA molecule synthesized? 3' - UUGCAUUGC - 5' 5' - AACGUAACG - 3' 3' - TTGCATTGC - 5' 5' - UUGCAUUGC - 3' 5' - AACGUAACG - 3' 3' - TTGCATTGC - 5
Maitreya E.
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
18,000,000+
Students on Numerade
Trusted by students at 8,000+ universities
Watch the video solution with this free unlock.
EMAIL
PASSWORD