A three amino acid protein is synthesized to combat a foreign invader. Below is the template strand for this protein. Give the mRNA and the amino acids necessary. 5' - GCT TTC CAT - 3'
Added by Susan H.
Step 1
The given template strand is 5' - GCT TTC CAT - 3'. Show more…
Show all steps
Your feedback will help us improve your experience
Derrick Danso and 71 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
The following DNA sequence is the TEMPLATE strand of a small gene. What is the amino acid sequence of the encoded peptide? 5'-GTCATGGCAACATAG-3
Derrick D.
Consider the coding strand DNA sequence within an exon below. What is the resulting mRNA sequence and the amino acid sequence? Use the dictionary provided above: CAATGACTTGCAGGACCCTGCGGTAG CAAUGAUUGCAGGACCCUGCGGUAG gln GUUACUGAACGUCCUGGGACGCCAUG val thr glu arg pro gly thr pro GUUACUGAACGUCCUGGGACGCCAUG met ala asp trp ser thr CAAUGAUUGCAGGACCCUGCGGUAG met thr cys arg thr leu arg
Madhur L.
2. For the DNA molecule shown below, the 5' Strand of DNA is transcribed into mRNA and then translated into protein. Indicate the correct mRNA and protein sequences in the spaces provided. (Note: spaces were added to make sequences line up for 5' and 3' strands-they do not indicate a "missing" base) DNA 5'GCTTGATCAGCTAGTCCATC GATCGGTCCTCGGAGCCCATTAAGGTAGC 3' DNA 3'CGAACTAGTCGATCAGGTAGCTAGCCAGGAGCCTCGGGTAATTCCATCG 5' mRNA 5' _________________________________________________________________________________ 3' Protein _________________________________________________________________________________ Alanine ALA A Arginine ARG R Aspartic Acid ASP D Asparagine ASN N Cysteine CYS C Glycine GLY G Glutamic Acid GLU E Glutamine GLN Q Histidine HIS H Isoleucine ISO I Leucine LEU L Lysine LYS K Methionine MET M Phenylalanine PHE F Proline PRO P Serine SER S Threonine THR T Tyrosine TYR Y Tryptophan TRP W Valine VAL V
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
Watch the video solution with this free unlock.
EMAIL
PASSWORD