are the number of fragments and sizes generated by ecori and pst1 digestion of the two genes same or different
Added by Victor J.
Step 1
In this case, we are looking at EcoRI and PstI. Each enzyme recognizes specific DNA sequences and cuts the DNA at those sites. Show more…
Show all steps
Your feedback will help us improve your experience
Supreeta N and 84 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
Sample #1 CAGTGATCTCGAATTCGCTAGTAACGTT GTCACTAGAGCTTAAGCGATCATTGCAA Sample #2 TCATGAATTCCTGGAATCAGCAAATGCA AGTACTTAAGGACCTTAGTCGTTTACGT If both of these samples are treated with the restriction enzyme EcoRI (recognition sequence GAATTC), indicate the number of fragments resulting from the digestion of each sample, and the size of the fragments from each sample. For the sizes of fragments, write out the number of base pairs in each. Number of fragments resulting from enzymatic digestion of Sample #1: Size of fragments resulting from enzymatic digestion of Sample #1: Number of fragments resulting from enzymatic digestion of Sample #2: Size of fragments resulting from enzymatic digestion of Sample #2:
Supreeta N.
2. Below is a restriction map for the plasmid pGEN102 (total length = 30 kb). Using this map as a guide, give the number of restriction fragments along with their associated lengths that would result from digesting pGEN102 with the restriction enzymes labeled on the plasmid. 3. Below is a restriction map for the plasmid pGEN103 (total length = 50 kb). Using this map as a guide, give the number of restriction fragments along with their associated lengths that would result from digesting pGEN103 with the restriction enzymes labeled on the plasmid.
Jenny W.
Question 5: An 6000 bp linear DNA fragment was digested with EcoRI, Bam HI, and Pst I and with pairwise combinations of these enzymes. Fragments were separated by electrophoresis on an agarose gel and visualised by staining with SafeView and observing under UV light. Fragment sizes were estimated by comparison with molecular weight size standards. The fragment sizes were estimated as follows: Restriction enzyme Fragment size (base pairs) Eco RI 4000, 2000 Bam HI 4500, 1500 Pst I 5000, 1000 Eco RI/Bam HI 2500, 2000, 1500 Eco RI/Pst I 3000, 2000, 1000 Bam HI/ Pst I 4500, 1000, 500 Construct the restriction map of this DNA fragment.
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
18,000,000+
Students on Numerade
Trusted by students at 8,000+ universities
Watch the video solution with this free unlock.
EMAIL
PASSWORD