3. Primer Design You are analyzing the region of DNA shown below to determine how many AATG repeats are present. To do so, you must amplify the entire region of AATG repeats. Design primers of 16 bases each so they anneal outside the region of interest. More than one primer pair is possible, but just give one. 5?-ACTGGCACAGAACAGGCACTTAGGAATGAATGAATGAATGAATGAATGAATGACCTGTGTGGTTCCCAGTTCCTCC-3? 3?-TGACCGTGTCTTGTCCGTGAATCCTTACTTACTTACTTACTTACTTACTTACTGGACACACCAAGGGTCAAGGAGG-5? a. Primer 1: Primer 2: b. Highlight the repeats in yellow. c. How many repeats of the AATG sequence are there? 4. PCR Product size You use the primers below in a PCR with the DNA in question 3 above. 5'-CTGGCACAGAACAGGCACTT -3' and 3'-ACACACCAAGGGTCAAGGAG -5' a. How long (in base pairs) will the PCR product be? b. How long would the PCR product be if there were 5 repeats? What about if there were 10 repeats?
Added by Alba H.
Close
Step 1
Primer 1: 5'-ACTGGCACAGAACAGG-3' Primer 2: 5'-GGGAACCACACAGGTC-3' The AATG repeats are highlighted as follows: ~ACTGGCACAGAACAGGCACTT(AATGAATGAATGAATGAATGAATG)ACCTGTGTGGTTCCCAGTTCCTCC-3 There are 5 repeats of the AATG sequence. Show more…
Show all steps
Your feedback will help us improve your experience
Josee Pacheco and 63 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
Consider the DNA sequence below. Design two 14-base primers to amplify the full length of the sequence. Pay attention to the polarity of each primer. For full points, do not add spaces in primers. 5’ TACCTTCCCA GGTAACAAAC CAACCAACTT TCGATCTCTT GTAGATCTGT TCTCTAAACG AACTTTAAAA TCTGTGTGGC TGTCACTCGG CTGCATGCTT AGTGCACTCA CGCAGTATAA 3’ Forward primer: 5' 3' Reverse primer: 5' 3' How many PCR products would you expect to see after the fifth cycle?
Sri K.
PCR primers must be complementary and anti-parallel to your sequence of interest. Two primers are used, one for each strand of DNA. Design primers 18-22 nt long to amplify the segment of DNA below. Indicate the 5' and 3' ends of your primers. For the sake of simplicity, only the coding strand of the DNA is shown below. The segment indicated as --- represents an internal sequence, 500 nt long: 5' A C A T G A G G G C T T G A C T G C T G C---G G T A T C C T A C G G T A A A G C T A T 3' Forward Primer : Reverse Primer :
Polymerase Chain Reaction One strand of a chromosomal DNA sequence is shown below. An investigator wants to amplify and isolate a DNA fragment defined by the segment shown in red, using the polymerase chain reaction (PCR). Design two PCR primers, each 20 nucleotides long, that can be used to amplify this DNA segment. The final PCR product generated with your primers should include no sequences outside the segment in red. (EQUATION CANNOT COPY)
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
18,000,000+
Students on Numerade
Trusted by students at 8,000+ universities
Watch the video solution with this free unlock.
EMAIL
PASSWORD