BELOW IS A SEGMENT OF DNA, WHICH WILL BE CUT WITH VARIOUS RESTRICTION ENZYMES CCATTCGATGAATTCTACGGATCCTTACTAAGCTTGGCGCCCCAGGATCCATTCGACCTA GGTAAGCTACTTAAGATGCCTAGGAATGATTCGAACCGCGGGGTCCTAGGTAAGCTGGAT 2. If the above DNA sequence is cut with Eco RI, how many DNA fragments will result? 3. If the above DNA sequence is cut with Hind III instead of Eco RI, how many DNA fragments will result? 4. If the above DNA sequence is cut with Eco RI and Bam HI, how many DNA fragments will result? (Hint: How many total cuts? You will need to add up the cuts from both enzymes. I recommend cutting with Bam HI and adding the number of fragments to the number you got in question number 2 since you have already calculated how many cuts Eco RI will make). 5. If DNA from two different people is cut with the same restriction enzymes and then run out on an agarose gel (gel electrophoresis), will the pattern of DNA banding in the gel be the same or different? Explain your answer.
Added by Brandi S.
Close
Step 1
Identify the restriction enzymes: These are proteins that can cut DNA at specific sequences. Common restriction enzymes include EcoRI, BamHI, HindIII, and others. Show more…
Show all steps
Your feedback will help us improve your experience
Adi S and 101 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
Cutting DNA with a particular restriction enzyme produces DNA fragments that can be separated by ______. A. enzymes B. gel electrophoresis C. recombinant DNA D. plasmids E. a genomic library
Adi S.
Enzymes used to cut genes in recombinant DNA research are... a. ligases b. restriction enzymes c. transcriptases d. DNA polymerases e. replicases
Sukhwinder N.
A. If the PCR shown in Figure $10-15$ is carried through an additional two rounds of amplification, how many of the DNA fragments labeled in gray, green, or red or outlined in yellow are produced? If many additional cycles are carried out, which fragments will predominate? B. Assume you start with one double-stranded DNA molecule and amplify a 500 -nucleotide-pair sequence contained within it. Approximately how many cycles of PCR amplification will you need to produce 100 ng of this DNA? $100 \mathrm{ng}$ is an amount that can be easily detected after staining with a fluorescent dye. (Hint: for this calculation, you need to know that each nucleotide has an average molecular mass of $330 \mathrm{g} / \mathrm{mole} .$
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
Watch the video solution with this free unlock.
EMAIL
PASSWORD