Below is the sequence of an mRNA molecule. Assuming there were no introns, 1. Write the corresponding DNA sequence below 2. How many amino acids long would the protein product of translation be for this mRNA? 3. How many tRNA molecules would be involved in making this protein? and Briefly describe the three things that occur before a mature messenger RNA is exported from the nucleus
Added by Daniel R.
Step 1
Step 1: The corresponding DNA sequence for the given mRNA sequence is: Template Strand: CGTCGCAATGCCAAGAATT Coding Strand: GCGAGCTTACGGTTCTTAA Show more…
Show all steps
Your feedback will help us improve your experience
Sri K and 89 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
If the sequence on the DNA molecule calls for a protein with the following DNA codons: 1) What would be the base sequence on mRNA? 2) What would be the base sequence on tRNA? 3) What would be the amino acid sequence of the protein being made? DNA TAC GGC CAT GTA ATA ACT mRNA tRNA amino acid sequence The statements listed below are the events in protein synthesis. Put the statements in the order in which they occur: (1 = first step - 6 = last step) The RNA is sent to the cytoplasm in the form of mRNA. mRNA attaches to a ribosome. Newly arriving amino acids are connected to the growing polypeptide by peptide bonds.
Sri K.
Below is a DNA molecule. Transcribe this molecule into RNA and then translate the RNA into an amino acid sequence using the genetic code written in RNA nucleotides provided below. Hint: make sure to begin translation from the start codon. a. Which strand of DNA (coding, non-coding) will you use to transcribe the mRNA? Coding Strand 5 TGACATGGGTACACATGACGGG 3 Non-Coding (Template) Strand 3 ACTGTACCCATGTGTACTGCCC 5 b. What is the mRNA sequence that would be transcribed from this DNA sequence? What is the protein sequence (amino acids) that will be translated from this mRNA molecule? Remember to look for the start codon.
Maitreya E.
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
Watch the video solution with this free unlock.
EMAIL
PASSWORD