Change a base without changing the amino acid in the reading frame between start and stop sequence
Added by Mario W.
Step 1
--- ** Show more…
Show all steps
Your feedback will help us improve your experience
Maitreya E and 92 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
How many bases can be added to or deleted from a sequence of DNA before the reading frame is returned to its original form (with the exception of the affected region of DNA)?
Maitreya E.
The following RNA sequence represents the beginning of an open reading frame. What changes (if any) can occur at each position without generating a change in the encoded amino acid residue? (5)AUGAUAUUGCUAUCUUGGACU
The nucleotide sequence 5' ...GGAGCUCGUUGUAUU... 3' is changed to 5' ...GGAGACUCGUUGUAUU... 3'. Why does or why doesn't the resulting amino acid sequence change? Refer to the following sequence: 5' ...GGAGCUCGUUGUAUU... 3' A premature stop codon caused by this change would result in a truncated polypeptide. The amino acid is not changed since the coding sequence was not changed at the 5' position. The reading frame, starting at the 5' end of this sequence, would be modified because of this change and so the entire amino acid would be different. Just one amino acid would be changed in the resulting polypeptide. Although the codon will change, the new codon will still code for the same amino acid in the sequence. The reading frame changes after the mutation and so the amino acid sequence is modified after that point.
Supreeta N.
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
18,000,000+
Students on Numerade
Trusted by students at 8,000+ universities
Watch the video solution with this free unlock.
EMAIL
PASSWORD
