Coding Strand of DNA (-25 +1 TAA...5 a. RNA Polymerase b. Promoters c. Transcription factors b) Transcribe the above DNA into a pre-mRNA molecule nucleus? d) Draw what the finished mRNA product will look like as it exits the nucleus. e. Translate the mRNA molecule into its final Amino Acid sequence f. Describe the process of Translation. Be sure to include details of Initiation, elongation, and Termination, including discussion of: a. Ribosomes b. Ribosome binding sites c. tRNA d. mRNA
Added by Carrie T.
Close
Your feedback will help us improve your experience
Adi S and 84 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
The following DNA strand is a template strand of a prokaryotic gene. Transcription start site is indicated by a bold "G". a) Underline the promoter region of this gene by a dotted line. b) Underscore the Pribnow box in the promoter region. What is the function of the Pribnow box? c) Deduce the nucleotide sequence of mRNA for this gene. d) Underscore the leader sequence in mRNA and box the initiation codon. How many amino acids does this mRNA code for? What is the sequence of the codons in this mRNA? e) Show 5' and 3' ends of the template strand and mRNA. f) What are the -10 and +10 base pairs of this gene? CCCTCCGTCGCTATAATGAAGTCGGAGACGGATGTACCGCGGATAA
Adi S.
51. The nucleotide sequence that tells RNA polymerase where to start synthesizing RNA is called (a) a 5' cap. (b) a promoter, (c) a an origin of replication, (d) a transcription factor, (e) a stop codon. 52. The sequence at the beginning of a new mRNA is called (a) a 5' cap. (b) a promoter, (c) a an origin of replication, (d) a transcription factor, (e) a stop codon. 53. The enzyme responsible for transcription is called (a) DNA polymerase, (b) RNA polymerase, (c) gyrase, (d) helicase, (e) acyl transferase. 54. The sequences that are removed from primary mRNA to form mature mRNA are called (a) introns, (b) exons, (c) promoters, (d) 5' caps, (e) stop codons.
Sri K.
In addition to RNA polymerase, transcription of DNA for the synthesis of $\mathrm{mRNA}$ requires (a) a control segment of DNA (also called an initiation sequence), (b) an informational strand of DNA, (c) a template strand of DNA, and (d) an end of the sequence (termination sequence). Determine the direction of RNA synthesis on the RNA strand in the following diagram. Draw in the locations of elements (a)-(d).
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
18,000,000+
Students on Numerade
Trusted by students at 8,000+ universities
Watch the video solution with this free unlock.
EMAIL
PASSWORD