Question

Coding Strand of DNA (-25 +1 TAA...5 a. RNA Polymerase b. Promoters c. Transcription factors b) Transcribe the above DNA into a pre-mRNA molecule nucleus? d) Draw what the finished mRNA product will look like as it exits the nucleus. e. Translate the mRNA molecule into its final Amino Acid sequence f. Describe the process of Translation. Be sure to include details of Initiation, elongation, and Termination, including discussion of: a. Ribosomes b. Ribosome binding sites c. tRNA d. mRNA

          Coding Strand of DNA (-25 +1
TAA...5
a. RNA Polymerase b. Promoters c. Transcription factors
b) Transcribe the above DNA into a pre-mRNA molecule
nucleus?
d) Draw what the finished mRNA product will look like as it exits the nucleus. e. Translate the mRNA molecule into its final Amino Acid sequence f. Describe the process of Translation. Be sure to include details of Initiation, elongation, and Termination, including discussion of: a. Ribosomes b. Ribosome binding sites c. tRNA d. mRNA
        
Show more…
coding strand of dna 25 1 taa5 arna polymerase bpromoters ctranscription factors btranscribe the above dna into a pre mrna molecule nucleus d draw what the finished mrna product will look li 32744

Added by Carrie T.

Close

Biology for AP Courses
Biology for AP Courses
Julianne Zedalis, John Eggebrecht
AceChat toggle button
Close icon
Ace pointing down

Please give Ace some feedback

Your feedback will help us improve your experience

Thumb up icon Thumb down icon
Thanks for your feedback!
Profile picture
Coding Strand of DNA (-25 +1 TAA...5 a. RNA Polymerase b. Promoters c. Transcription factors b) Transcribe the above DNA into a pre-mRNA molecule nucleus? d) Draw what the finished mRNA product will look like as it exits the nucleus. e. Translate the mRNA molecule into its final Amino Acid sequence f. Describe the process of Translation. Be sure to include details of Initiation, elongation, and Termination, including discussion of: a. Ribosomes b. Ribosome binding sites c. tRNA d. mRNA
Close icon
Play audio
Feedback
Powered by NumerAI
Ivan Kochetkov Jennifer Stoner
Danielle Fairburn verified

Adi S and 84 other subject Biology educators are ready to help you.

Ask a new question

*

Labs

-

Want to see this concept in action?

NEW

Explore this concept interactively to see how it behaves as you change inputs.

View Labs

*

Key Concepts

-
Key Concept
Premium Feature
Explore the core concept behind this problem.
Play button
Key Concept
Premium Feature
Explore the core concept behind this problem.
Your browser does not support the video tag.

*

Recommended Videos

-
1-the-following-dna-strand-is-a-template-strand-of-a-prokaryotic-genetranscription-start-siteis-indicated-by-a-bold-g-a-underline-the-promoter-region-of-this-gene-by-a-dotted-line-bunderscor-11918

The following DNA strand is a template strand of a prokaryotic gene. Transcription start site is indicated by a bold "G". a) Underline the promoter region of this gene by a dotted line. b) Underscore the Pribnow box in the promoter region. What is the function of the Pribnow box? c) Deduce the nucleotide sequence of mRNA for this gene. d) Underscore the leader sequence in mRNA and box the initiation codon. How many amino acids does this mRNA code for? What is the sequence of the codons in this mRNA? e) Show 5' and 3' ends of the template strand and mRNA. f) What are the -10 and +10 base pairs of this gene? CCCTCCGTCGCTATAATGAAGTCGGAGACGGATGTACCGCGGATAA

Adi S.

51-_-the-nucleotide-sequence-that-tells-rna-polymerase-where-to-start-synthesizing-rna-is-called-a-a-5-cap-6-promoter-c-origin-of-rcplication-d-transcription-factor-e-stop-codon_-52-the-scqu-57202

51. The nucleotide sequence that tells RNA polymerase where to start synthesizing RNA is called (a) a 5' cap. (b) a promoter, (c) a an origin of replication, (d) a transcription factor, (e) a stop codon. 52. The sequence at the beginning of a new mRNA is called (a) a 5' cap. (b) a promoter, (c) a an origin of replication, (d) a transcription factor, (e) a stop codon. 53. The enzyme responsible for transcription is called (a) DNA polymerase, (b) RNA polymerase, (c) gyrase, (d) helicase, (e) acyl transferase. 54. The sequences that are removed from primary mRNA to form mature mRNA are called (a) introns, (b) exons, (c) promoters, (d) 5' caps, (e) stop codons.

Sri K.

in-addition-to-rna-polymerase-transcription-of-dna-for-the-synthesis-of-mathrmmrna-requires-a-a-cont

In addition to RNA polymerase, transcription of DNA for the synthesis of $\mathrm{mRNA}$ requires (a) a control segment of DNA (also called an initiation sequence), (b) an informational strand of DNA, (c) a template strand of DNA, and (d) an end of the sequence (termination sequence). Determine the direction of RNA synthesis on the RNA strand in the following diagram. Draw in the locations of elements (a)-(d).

Fundamentals of General, Organic, and Biological Chemistry


*

Recommended Textbooks

-
Biology for AP Courses

Biology for AP Courses

Julianne Zedalis, John Eggebrecht
achievement 1,337 solutions
Objective Biology for NEET

Objective Biology for NEET

Rajiv Vijay 1st Edition
achievement 1,984 solutions
Introduction to General, Organic and Biochemistry

Introduction to General, Organic and Biochemistry

Frederick A. Bettelheim, William H. Brown, Mary K. Campbell 12th Edition
achievement 1,999 solutions

*

Transcript

-
00:01 T -a -t -a -t -a -t -t -a -t -t -t -t -t -t -t -t -t -t -rota -t -rote -romo -rotes present in a promoter region in a template strand of dna and is essential...
Need help? Use Ace
Ace is your personal tutor. It breaks down any question with clear steps so you can learn.
Start Using Ace
Ace is your personal tutor for learning
Step-by-step explanations
Instant summaries
Summarize YouTube videos
Understand textbook images or PDFs
Study tools like quizzes and flashcards
Listen to your notes as a podcast
Continue solving this problem
Create a free account to:
  • View full step-by-step solution
  • Ask follow-up questions with Ace AI
  • Save progress and study later
Continue Free
Join the community

18,000,000+

Students on Numerade


Trusted by students at 8,000+ universities

Numerade

Get step-by-step video solution
from top educators

Continue with Clever
or



By creating an account, you agree to the Terms of Service and Privacy Policy
Already have an account? Log In

A free answer
just for you

Watch the video solution with this free unlock.

Numerade

Log in to watch this video
...and 100,000,000 more!


EMAIL

PASSWORD

OR
Continue with Clever