Define BLAST. BLAST is part of the Human Genome Project which deals with military applications of genome information. BLAST is the software used to automate the DNADNA sequencing process. BLAST is the software that directs searches through databanks of DNADNA and protein sequences. BLAST is the software used to determine the primary structure of proteins. Part B Choose basic features of this bioinformatics tool. Select all that apply. might find identical or similar sequences only in the same species directs searches through databanks of DNADNA directs searches through databanks of protein sequences identifies matches that align in whole directs searches through databanks of DNADNA primers identifies matches that align in part might find the promoter or terminator for the selected gene
Added by Melissa J.
Step 1
BLAST stands for Basic Local Alignment Search Tool. It is a software that allows researchers to compare a query sequence (DNA or protein) against a database of known sequences to identify similar or identical sequences. Now, let's choose the basic features of Show more…
Show all steps
Your feedback will help us improve your experience
Madhur L and 81 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
Select all the applications that could be performed using the BLAST program. Check All That Apply (multiple answers) - Searching for sequences in other organisms that are homologous to a predicted human gene. - Searching for sequences in other organisms that are homologous to a predicted human gene. - Searching for a human protein sequence that is homologous to a mouse gene. - Searching for a human protein sequence that is homologous to a mouse gene. - Searching for a human nucleotide sequence that is homologous to a canine gene. - Searching for a human nucleotide sequence that is homologous to a canine gene. - Searching for DNA polymorphisms in a human gene.
Keemin L.
When enhancers were initially found to influence transcription many thousands of nucleotide pairs from the promoters they control, two principal models were invoked to explain this action at a distance. In the "DNA looping" model, direct interactions between proteins bound at enhancers and promoters were proposed to stimulate transcription initiation. In the "scanning" or "entry-site" model, RNA polymerase (or another component of the transcription machinery) was proposed to bind at the enhancer and then scan along the DNA until it reached the promoter. These two models were tested using an enhancer on one piece of DNA and a $eta$ -globin gene and promoter on a separate piece of DNA. The $eta$ -globin gene was not expressed from the mixture of pieces. However, when the two segments of DNA were joined via a linker (made of a protein that binds to a small molecule called biotin), the $eta$ -globin gene was expressed. Does this experiment distinguish between the DNA looping model and the scanning model? Explain your answer.
Sri K.
You are given the following sequencing result: >Sequence 1 GCATTCTGAGGCATTCTCTAACAGGTTCTCGACCCTCCGCCATGGCCCCGTGGATGCATCTCCTCACCGT GCTGGCCCTGCTGGCCCTCTGGGGACCCAACTCTGTTCAGGCCTATTCCAGCCAGCACCTGTGCGGCTCC AACCTAGTGGAGGCACTGTACATGACATGTGGACGGAGTGGCTTCTATAGACCCCACGACCGCCGAGAGC TGGAGGACCTCCAGGTGGAGCAGGCAGAACTGGGTCTGGAGGCAGGCGGCCTGCAGCCTTCGGCCCTGGA GATGATTCTGCAGAAGCGCGGCATTGTGGATCAGTGCTGTAATAACATTTGCACATTTAACCAGCTGCAG AACTACTGCAATGTCCCTTAGACACCTGCCTTGGGCCTGGCCTGCTGCTCTGCCCTGGCAACCAATAAAC CCCTTGAATGAG Task: You are required to go to the BLAST website and look for the answer to the following questions: [Note: When performing the BLAST, use all the default settings as on the website, EXCEPT for the "Program Selection," choose "optimize for Somewhat similar sequences (blastn)"] a) How long is the sequence that you used to search the database? b) What is the most likely identity of this sequence? What data supports this conclusion? c) What organism is the source of the sequence? What is the common name for this organism? d) What phylum contains this organism? e) What is the accession number for this sequence? f) Is this sequence expressed? How do you know? g) If your sequence is expressed, where (tissue) is it expressed? h) Is anything known about factors that cause your sequence to be expressed? i) How many sequences can you find with an E-value less than or equal to 1 X 10-60? j) Look at the first matching sequence, how long is the extent of the alignment, and what fraction of the nucleotides match?
Adi S.
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
Watch the video solution with this free unlock.
EMAIL
PASSWORD