Despite the NOD2 mutation being classified as a “loss of function” mutation, cells affected with the mutation seem to have a hyper reactive immune system and an overall “gain of function”. How could this be possible?
Added by Sarah O.
Step 1
NOD2 is a pattern recognition receptor that plays a crucial role in the innate immune response by recognizing bacterial components, particularly muramyl dipeptide (MDP). It helps to activate signaling pathways that lead to the production of pro-inflammatory Show more…
Show all steps
Your feedback will help us improve your experience
Adi S and 62 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
Gaucher disease, the most common lysosomal storage disease in humans, is caused by mutations in the gene encoding glucocerebrosidase (GCase), the lysosomal enzyme that degrades glucocerebrosides. The disease has a variety of symptoms depending on the severity of the disease and the person affected. Identical twins can display very different levels of severity. Symptoms include bone pain, enlarged liver, excessive fatigue, and mental retardation. In order to better understand the disease, researchers undertook a series of experiments to characterize the nature of the defect in the enzyme. Cells were obtained from a person without the disease (control) as well as from a patient with the disease (GD). The cells were grown in culture, the enzyme was isolated, and enzyme activity of $10 mu mathrm{g}$ of each sample was measured (Figure mathrm{A} ). (a) What do the results tell about the catalytic activity of the enzyme from the GD cells? Why were these results surprising to the researchers? Again, cells were grown in culture and cell extracts were made from the control and GD samples. Care was taken to insure that the same number of cells were used in both extractions. A western blot with antibodies to GCase was performed on the cell extracts, with the results shown in Figure B. (b) Provide two possible explanations for the result shown in Figure $B$. Why was it crucial to insure that the extract was made from the same number of cells? What was the purpose of including the western blot of actin? (c). The researchers then measured the amount of mRNA for the enzyme in both the control and GD cells. The amount of mRNA was identical in the two samples. With this information, reinterpret the results shown in Figure B. Next, cells from the control and GD individuals were grown in the presence and absence of a potent proteasome inhibitor. The amount of GCase was determined using western blots. The results are shown in Figure mathrm{C}. (d) Suggest the nature of the defect in the GD enzyme. What is the significance of the increase in activity of the enzyme from the normal cell observed in the presence of the inhibitor?
Adi S.
Crohn's disease is caused by a mutation in the NOD2 gene. When there is no mutation, normal protein will be synthesized, which is able to respond to bacterial lipopolysaccharides. Mutations alter the protein that is coded by the NOD2 gene in a way that prevents the protein from being responsive. The NOD2 gene is sequenced from two patients. Patient A has mild symptoms, while patient B has very severe symptoms. By looking at the sequencing result, state which sample belongs to patient A and which one belongs to patient B. Explain your reason: WT NOD2 gene: 3' AGGCTACTTTGCGAGGACACAAACCATTTTATC 5' Sample 1: 3' AGGCTACTTTGCGAGGACACGAACCATTTTATC 5' Sample 2: 3' AGGCTACTTTGCGGAGGACACGAACCATTTTATC 5
Why don’t all loss-of-function mutations that are recessive at the cellular level behave as dominants at the organismal level? Is this property restricted to tumor-suppressor gene mutations?
Lainey R.
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
18,000,000+
Students on Numerade
Trusted by students at 8,000+ universities
Watch the video solution with this free unlock.
EMAIL
PASSWORD