During DNA replication, the DNA strands must be separated in order to be copied. What type of bonds connect the bases in the center of the two DNA strands?
Added by Lisa N.
Close
Step 1
Step 1: The question asks about the type of bonds that connect the bases in the center of the two DNA strands. Show more…
Show all steps
Your feedback will help us improve your experience
Adi S and 56 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
DNA molecule made of four bonds. There are three hydrogen bonds formed between the bases and two covalent bonds between the chains which are held together in the DNA molecule. The polynucleotide chains are antiparallel to each other. For the following base sequence, one strand of DNA gives the base sequence of its complementary strand: 5'GGATCTGATCCAGTCGCATAT C: DNA replication DNA replication begins at a specific site in the DNA molecule called the origin of replication. Refer to your textbook to complete the following table: Enzyme Steps of DNA Replication Untwists and separates the two strands of DNA Relieves the twisting supercoiling in DNA Synthesizes RNA primer Adds complementary nucleotides in the 5' to 3' direction Removes RNA primer and replaces it with DNA nucleotides Joins Okazaki fragments During DNA replication, DNA polymerase reads the DNA sequence in the 3' to 5' direction. Nucleotides are added only at the 3' end of the growing DNA chain, resulting in the new strand growing in the 5' to 3' direction. During DNA replication, the DNA strand that is synthesized continuously is called the leading strand, while the other strand is synthesized in pieces called the lagging strand.
Adi S.
#7: Cytosine, guanine, thymine, and adenine are the nitrogen bases of the nucleic acid DNA. #8: The DNA double helix consists of two antiparallel strands. #9: Helicase untwists and separates the double-stranded DNA at the replication fork. #10: DNA Replication is performed in S phase of interphase. #11: Adenine always pairs with thymine. #12: Complementary base pairing matches up complementary nitrogen bases. #13: The lagging strand in DNA replication is synthesized discontinuously in pieces called Okazaki fragments. #14: Replication results in two strands of DNA, each of which contains one original strand and one newly synthesized strand. #15: Hydrogen bonds hold nitrogen bases together, keeping the two DNA strands together. Use semiconservative DNA replication to build the leading and lagging strands and label RNA primers.
Jenny W.
Sri K.
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
18,000,000+
Students on Numerade
Trusted by students at 8,000+ universities
Watch the video solution with this free unlock.
EMAIL
PASSWORD