Genetic Code: Using the standard genetic code, write a sequence encoding the peptide "MASTERMIX". How many different sequences can encode this peptide? How many genetic codes have been described? (Hint: search NCBI Genetic Codes) How, in a general way, do these alternative codes tend to differ from the standard genetic code? How is selenocysteine encoded?
Added by Jessica G.
Step 1
Using the standard genetic code, write a sequence encoding the peptide "MASTERMIX": The sequence would be: AUGAGUAGUCCAGUCCAUCAUC Show more…
Show all steps
Your feedback will help us improve your experience
Adi S and 60 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
How many different genetic codes variants are there? Pick the closest answer 1-there is only a single genetic code for all organisms 2-each organim has its own specific genetic code 3-presently around 33 different variants are known 4-there are exactly 23=64 genetic codes 5-around 20,000 genetic codes have been described in the PDB
Maryam R.
(a) Why is the genetic code a triplet code instead of a singlet or doublet code? (b) How many different amino acids are specified by the genetic code? (c) How many different amino acid sequences are possible in a polypeptide 146 amino acids long?
Joanna Q.
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
18,000,000+
Students on Numerade
Trusted by students at 8,000+ universities
Watch the video solution with this free unlock.
EMAIL
PASSWORD