Given the strand of mRNA, translate it into the correct amino acid sequence (watch for the start and stop) mRNA – G G A A U G G A C U C G C G A A U G G G C C G A U A G U C A – Protein:
Added by Kenneth P.
Step 1
First, we need to find the start codon (AUG) in the mRNA sequence. mRNA – G G A A U G G A C U C G C G A A U G G G C C G A U A G U C A Show more…
Show all steps
Your feedback will help us improve your experience
Madhur L and 59 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
Transcribe the following DNA strands into mRNA and translate those strands into a polypeptide chain, identifying the codons, anticodons, and amino acid sequence. DNA: C G A T A C A A T G G A C C C G G T A T G C G A T A T C C DNA: G T A C G C G T A T A C C G A C A T T C DNA: T A C A T C T T G G C G A C G A C T
Adi S.
Write the tRNA sequence for the given strand of mRNA (Ignore start and stop codons) 5'- AGGUCAUGCAUGGGCAUGCAU -3' Label the RNA strand below, consider how Crick and Brenner read DNA. Translate the amino acid sequence for the given mRNA strand. Remember that codons are 3 base pairs long. (DO NOT ignore start and stop codons) a. 5'- AUG CAC UGU CCU UUC GCU GAC UAA -3' b. 5'- GAG AUG AUC UGG UUG GAA UCG UGA -3'
Dave K.
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
Watch the video solution with this free unlock.
EMAIL
PASSWORD