Question

Here is the DNA sequence of a small prokaryotic genome. Coding strand 5' GGTAAGGAGGTTATATGCACGGCATCTGATTTTAA3' Template strand 3' CCATTCCTCCAATATACGTGCCGTAGACTAAAATT5' 1. Predict the sequence of mRNA. (The +1 site is the first base of the sequence.) On the sequence, label the location of 5' UTR, 3' UTR, and shine dalgarno sequence. 2. Predict the amino acid protein sequence that can be translate from the mRNA sequence using the codon table below. (The first Met is the start codon) 3. For each amino acid in the mRNA above, list all the possible codons that call for that particular amino acid, using the codon table below. Then, using the wobble rules in the table, determine the fewest number of anticodon(s) that are sufficient to base pair with every codon. Be sure that the anti-codon(s) you list can ONLY pair with the codons for that amino acid (and not with any codons that call for a different amino acid).

          Here is the DNA sequence of a small prokaryotic genome.
Coding strand 5' GGTAAGGAGGTTATATGCACGGCATCTGATTTTAA3'
Template strand 3' CCATTCCTCCAATATACGTGCCGTAGACTAAAATT5'

1. Predict the sequence of mRNA. (The +1 site is the first base of the sequence.) On the sequence, label the location of 5' UTR, 3' UTR, and shine dalgarno sequence.

2. Predict the amino acid protein sequence that can be translate from the mRNA sequence using the codon table below. (The first Met is the start codon)

3. For each amino acid in the mRNA above, list all the possible codons that call for that particular amino acid, using the codon table below. Then, using the wobble rules in the table, determine the fewest number of anticodon(s) that are sufficient to base pair with every codon. Be sure that the anti-codon(s) you list can ONLY pair with the codons for that amino acid (and not with any codons that call for a different amino acid).

Here is the DNA sequence of a small prokaryotic genome.
Coding strand 5' GGTAAGGAGGTTATATGCACGGCATCTGATTTTAA3'
Template strand 3' CCATTCCTCCAATATACGTGCCGTAGACTAAAATT5'

1. Predict the sequence of mRNA. (The +1 site is the first base of the sequence.) On the sequence, label the location of 5' UTR, 3' UTR, and shine dalgarno sequence.

2. Predict the amino acid protein sequence that can be translate from the mRNA sequence using the codon table below. (The first Met is the start codon)

3. For each amino acid in the mRNA above, list all the possible codons that call for that particular amino acid, using the codon table below. Then, using the wobble rules in the table, determine the fewest number of anticodon(s) that are sufficient to base pair with every codon. Be sure that the anti-codon(s) you list can ONLY pair with the codons for that amino acid (and not with any codons that call for a different amino acid).

Added by Thomas B.

Question

Please give Ace some feedback