How are the sugars and nitrogenous bases in DNA and RNA different? What template molecule do we need to make mRNA? Where in the cell does transcription take place? What enzyme catalyzes transcription? What is produced by transcription? If the following DNA sequence served as the template for transcription, what mRNA would be produced? T A C A G C T A A G C T What are the three different varieties of RNA involved in translation? What role or purpose do each of them serve?
Added by Christopher H.
Step 1
The sugars in DNA and RNA are different: DNA has deoxyribose sugar, while RNA has ribose sugar. The nitrogenous bases in DNA are adenine (A), guanine (G), cytosine (C), and thymine (T), while in RNA, thymine is replaced by uracil (U). Show more…
Show all steps
Your feedback will help us improve your experience
Adi S and 59 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
Adi S.
a. How do DNA and RNA differ? b. Explain the base pairing rules for DNA and RNA c. In which direction does genetic information flow? d. Where do the two stages of information flow occur? e. Transcribe the following DNA sequence into RNA sequence: AAAGGGGTTCGTAGTGAACCCGTAGTCGTGCGT CGATGCAGTTTAGCATGATCGATGCTAG f. Explain transcription. g. What are the features of a finalized mRNA after RNA Modification? h. What is a codon? i. What amino acids do these codons translate into? GUC, AAG, UAU j. Explain translation.
What are the sugars in DNA and RNA, and how do they differ?
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
Watch the video solution with this free unlock.
EMAIL
PASSWORD