If one strand of a DNA molecule has the sequence of bases 3'ATTGCA 5', the other complementary strand would have the sequence Select one: a. 3'TAACGT5' b. 5'UAACGU3' c. 3'UAACGU5' d. 5'TAACGT3'
Added by Cheryl M.
Close
Step 1
The complementary base pairs in DNA are Adenine (A) with Thymine (T) and Cytosine (C) with Guanine (G). Show more…
Show all steps
Your feedback will help us improve your experience
Madhur L and 80 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
If the sequence of bases in one strand of DNA is 5? TAGCCT 3?, then the sequence of bases in the other strand is a. 3? TCCGAT 5?. c. 3? TAGCCT 5?. b. 3? ATCGGA 5?. d. 3? AACGGUA 5?.
If one strand of DNA is 5' TTCATTGGCGTTAACGATTA 3', then the complementary DNA strand would start: Select one: A. 5' AAGTAA...3' B. 5' TAATCG...3' C. 5' UAAUCG...3' D. 5' ATTAGC...3' E. 5' UUCAUU...3'
Sri K.
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
18,000,000+
Students on Numerade
Trusted by students at 8,000+ universities
Watch the video solution with this free unlock.
EMAIL
PASSWORD