Label the different molecules/enzymes involved in the following processes: Transcription Translation For each of the following items, transcribe the DNA into mRNA and translate it into amino acids. DNA: 3’-TACGCATAACCCGCACTCGACATT-5’ mRNA: ______________________________ Amino acids: ______________________________ DNA: 3’-TACTAAGCTACACGTGTTACAACT-5’ mRNA: ______________________________ Amino acids: ______________________________ DNA: 3’-TACCAATCTGACTAGGCGTATATC-5’ mRNA: ______________________________ Amino acids: ______________________________
Added by Elizabeth H.
Step 1
Step 1: Transcribe the given DNA sequences into mRNA sequences using the complementary base pairing rule. Show more…
Show all steps
Your feedback will help us improve your experience
Sri K and 101 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
Complete the flowchart below for replication, transcription, and translation. First, complete the complementary strand for DNA. Then, make an RNA transcript. Finish by completing the amino acid sequence along with anticodons for tRNA. Label the 5' and 3' ends. The codon table is given at the end of the sheet. (8 marks) 5' ATGGCAGCCTTCAGCTTAACCGCA 3' DNA mRNA tRNA (anticodons) Amino acids
Marlyn J.
Transcribe the mRNA from the following template DNA sequence. Clearly label the 5' and 3' ends. 3'-TAC AAA TTC GGC-5' Translate the mRNA sequence from the previous question to an amino acid sequence. Use the three-letter amino acid code.
Madhur L.
Describe the process by which the information in a eukaryotic gene is transcribed and translated into a protein. Correctly use these words in your description: tRNA, amino acid, start codon, transcription, RNA splicing, exons, introns, mRNA, gene, codon, RNA polymerase, ribosome, translation, anticodon, peptide bond, stop codon.
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
18,000,000+
Students on Numerade
Trusted by students at 8,000+ universities
Watch the video solution with this free unlock.
EMAIL
PASSWORD